Báo cáo y học: "Inhibition of oncogene-induced inflammatory chemokines using a farnesyltransferase inhibitor" pot

Báo cáo y học: "Inhibition of allogeneic inflammatory responses by the Ribonucleotide Reductase Inhibitors, Didox and Trimidox" pot

Báo cáo y học: "Inhibition of allogeneic inflammatory responses by the Ribonucleotide Reductase Inhibitors, Didox and Trimidox" pot

... carried out the T-cell isolation, T-cell proliferation, cytokine analysis and MLR and analysis of the data. IE participated in the T-cell proliferation assays and statistical analysis. MB participated ... disease. Acknowledgements We are very grateful to Dr. Beth A. Garvy and Yajarayma Tang-Feldman for their critical review of the manuscript and helpful discussions. This work was support...

Ngày tải lên: 11/08/2014, 06:22

11 304 0
Báo cáo y học: "Inhibition of oncogene-induced inflammatory chemokines using a farnesyltransferase inhibitor" pot

Báo cáo y học: "Inhibition of oncogene-induced inflammatory chemokines using a farnesyltransferase inhibitor" pot

... [sense: 5' GCGGAGAGATGAGAGTCTGG 3'; antisense: 5' GAGAC- GAGAAGGAGCATTGG 3']; human RP3 (breakpoint region) [sense: 5' CCAGAGCAGAAGTCAGCATTC 3'; anti- sense: 5' ... treatment of advanced malignancies in clinical tri- als. One explanation for these failures may be that FTIs modulate alternate targets and the assumed dependency on Ras signaling in cancer may...

Ngày tải lên: 11/08/2014, 08:21

8 306 0
Báo cáo y học: "Expression of the inflammatory chemokines CCL5, CCL3 and CXCL10 in juvenile idiopathic arthritis, and demonstration of CCL5 production by an atypical subset of CD8+ T cells" pps

Báo cáo y học: "Expression of the inflammatory chemokines CCL5, CCL3 and CXCL10 in juvenile idiopathic arthritis, and demonstration of CCL5 production by an atypical subset of CD8+ T cells" pps

... CCTAGCTCATCTCCAAA- GAG; CCL3, forward ATGCAGGTCTCCACTGCTGC, reverse TCAGGCACTCAGCTCCAGGTC; CXCL10, for- ward AAGGATGGACCACACAGAGG, reverse ACCCTT- GGAAGATGGGAAAG. Control primers for human β-actin were ... Software (LabVelocity, San Francisco, CA, USA), were: β-actin, AGAAAATCTGGCAC- CACACC; CCL5, AACCCAGCAGTCGTCTTTGT. Densit- ometry analysis was performed using the Bio-Rad FX imager (Bio-R...

Ngày tải lên: 09/08/2014, 07:20

11 509 0
Báo cáo y học: " Extension of Murray''''s law using a non-Newtonian model of blood flow" pptx

Báo cáo y học: " Extension of Murray''''s law using a non-Newtonian model of blood flow" pptx

... 245(6):H1031-H1038. 8. Suwa N, Niwa T, Fukasuwa H, Sasaki Y: Estimation of intravascu- lar blood pressure gradient by mathematical analysis of arte- rial casts. Tohoku J Exp Med. 1963, 79:168-198. 9. Sherman TF: ... the ratio of the combined cross-sectional area of the daughters over that of the parent vessel. Values of β greater than unity produce expansion in the total cross-s...

Ngày tải lên: 13/08/2014, 16:21

9 360 0
Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt

Tài liệu Báo cáo Y học: Inhibition of the MEK/ERK signaling pathway by the novel antimetastatic agent NAMI-A down regulates c-myc gene expression and endothelial cell proliferation ppt

... of DNA synthesis and cell proliferation of human mammary myoepithelial-like cells by hepatocyte growth factor/scatter factor depends on heparan sulfate proteoglycans and sustained phosphorylation ... that NAMI -A- mediated inhibition of ERK1/2 phosphorylation may be lying upstream of ERK1/2. Using a serine/threonine kinase SPA assay kit, the capability of NAMI -A to affect the...

Ngày tải lên: 21/02/2014, 01:21

10 703 0
Tài liệu Báo cáo Y học: Inhibition of nuclear pre-mRNA splicing by antibiotics in vitro pot

Tài liệu Báo cáo Y học: Inhibition of nuclear pre-mRNA splicing by antibiotics in vitro pot

... three of the ®ve spliceosomal snRNAs, U 2, U5 and U6, in pa rticular are potent ially major RNA targets of erythromycin. They are central participants of complex C and all are required in the catalytic ... pre-mRNA analyzed by a band-shift assay. Each antibio tic (500 l M )was incubated with the RNA [sense (S) or an ti- sense (A) ] at 30 °C for 15 min. The samples were separated on a...

Ngày tải lên: 21/02/2014, 15:20

9 587 0
Báo cáo Y học: Inhibition of hyaluronan synthesis in Streptococcus equi FM100 by 4-methylumbelliferone doc

Báo cáo Y học: Inhibition of hyaluronan synthesis in Streptococcus equi FM100 by 4-methylumbelliferone doc

... tumour-associated hyaluronan. CIBA Found. Symp 13, 150–159. 5. Kosaki, R., Watanabe, K. & Yamaguchi, Y. (1999) Over- production of hyaluronan by expression of the hyaluronan synthase Has2 enhances ... Netherlands. 25. Sohara, Y. , Ishiguro, N., Machida, K., Kurata, H., Thant, A. A., Senga, T., Matsuda, S., Kimata, K., Iwata, H. & Hamaguchi, M. (2001) Hyaluronan activates cell m...

Ngày tải lên: 08/03/2014, 09:20

10 541 0
Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

Báo cáo Y học: Inhibition of the SERCA Ca21 pumps by curcumin Curcumin putatively stabilizes the interaction between the nucleotide-binding and phosphorylation domains in the absence of ATP pot

... effects of curcumin were investigated on Ca 2þ ATPase activity as a function of [Ca 2þ ] and [ATP], these were carried out on purified SR Ca 2þ -ATPase using a coupled enzyme assay as previously described ... give a stock solution of 10 m M. Ca 21 -ATPase activity Ca 2þ -ATPase activity determination in microsomes was performed using the phosphate liberation assay as described...

Ngày tải lên: 08/03/2014, 23:20

10 594 0
Báo cáo Y học: Inhibition of glycosyl-phosphatidylinositol biosynthesis in Plasmodium falciparum by C-2 substituted mannose analogues pot

Báo cáo Y học: Inhibition of glycosyl-phosphatidylinositol biosynthesis in Plasmodium falciparum by C-2 substituted mannose analogues pot

... plasma membrane (reviewed in [1–6]). GPtdIns from parasitic protozoa have been related to the pathology of many parasitic diseases [5]. The human malaria parasite, Plasmodium falciparum, has ... Vivas, L., Ogun, S .A. , Azzouz, N., Brown, K.N., Holder, A. A. & Schwarz, R.T. (1997) Glycosylphosphatidylinositols of Plasmodium chabaudi chabaudi: a basis for the study of malarial gly...

Ngày tải lên: 31/03/2014, 23:20

8 334 0
Báo cáo Y học: Inhibition of SERCA Ca2+ pumps by 2-aminoethoxydiphenyl borate (2-APB) 2-APB reduces both Ca2+ binding and phosphoryl transfer from ATP, by interfering with the pathway leading to the Ca2+-binding sites ppt

Báo cáo Y học: Inhibition of SERCA Ca2+ pumps by 2-aminoethoxydiphenyl borate (2-APB) 2-APB reduces both Ca2+ binding and phosphoryl transfer from ATP, by interfering with the pathway leading to the Ca2+-binding sites ppt

... effects of 2-APB on the activity of the purified Ca 2+ -ATPase were investigated, were carried out using a coupled enzyme assay as previously described [22]. Typically, 15 lgofATPaseproteinwas added ... Activities of the Ca 2+ ATPase were measured at 37 °C, using the coupled enzyme assay, at either pH 7.2 (A) or pH 6.0 (inset). The activity of purified Ca 2+ ATPase was also measur...

Ngày tải lên: 31/03/2014, 23:20

10 412 0
w