Báo cáo y học: "Host predisposition by endogenous Transforming Growth Factor-β1 overexpression promotes pulmonary fibrosis following bleomycin injury" docx

... Inflammation Open Access Research Host predisposition by endogenous Transforming Growth Factor-β1 overexpression promotes pulmonary fibrosis following bleomycin injury Yussef Haider 1 , Andrea P Malizia 2 , ... the Tr- wild type group. These data determine the dose response nature of lung injury following exposure to bleomycin. Lung fibrosis induced by 4500 IU...

Ngày tải lên: 11/08/2014, 08:21

... ineffective in promoting proteoglycan synthesis by chondrocytes. By contrast, 2.7 nM R 3 IGF-1 significantly stimulated total proteoglycan synthesis, by 45% over that by unstimulated cells. Since ... restoration of proteoglycan synthesis by human OA chondrocytes. IGFBPs secreted by human OA cartilage or cultured chondrocytes were analyzed by western ligand blot. The ability of...

Ngày tải lên: 09/08/2014, 01:23

... analyses of differentially expressed genes To validate the results of the array analysis, differentially expressed genes of the TGF-β pathway were analyzed by independent qPCR. A significantly ... such pathway components in RA and OA SFBs may then indicate a more pronounced potency for further activation by the respective cytokines or growth factors, for example, transforming growth...

Ngày tải lên: 09/08/2014, 10:20

... 5'-3'AGAGAAAGAAAAAGGGAAAGGTAAGTTT COL1A2, collagen type I alpha 2; COL2A1, collagen type II alpha 1; HIF, hypoxia inducible factor; P4H, prolyl 4-hydroxylase; PHD, HIF prolyl hydroxylase; SOX, Sry-related HMG box-9. Arthritis ... articular chondrocytes by 5% oxygen tension. This may therefore reflect a greater sensitivity of meniscus cells to oxygen tension. Naturally, articular...

Ngày tải lên: 09/08/2014, 10:20

... immunoassays. MY performed the permeability study using endothelial mon- olayers. EI carried out the immunoassays. YA participated in the design of the study and performed the statistical analysis. ... of Medicine, Tokyo, Japan, 3 Laboratory of Immunopharmacology of Microbial Products, Tokyo University of Pharmacy and Life Science, Tokyo, Japan and 4 Department of Emergency and Critical C...

Ngày tải lên: 12/08/2014, 15:21

... flk-1 in animal models caused pulmonary hypertension charac- terized by thickening of the medial layer of pulmonary arteries in normoxic conditions. Additionally, in hypoxic conditions, the inhibition ... lung injury and acute respiratory distress syndrome The acute respiratory distress syndrome (ARDS) is the most extreme manifestation of acute lung injury (ALI) [26]. Pulmonary injury...

Ngày tải lên: 12/08/2014, 16:20

... and idiopathic pulmonary fibrosis. Am Rev Respir Dis 1986, 133:855-860. 30. Yamadori I, Fujiata J, Kajitani H, Tokuda M, Yang Y, Ohtsuki Y, Yoshi- nouchi T, Kamei T, Ishida T: Lymphocytic subsets ... Atamas SP, Yurovsky VV, Wise R, Wigley FM, Goter Robinson CJ, Henry P, Alms WJ, White B: Production of type 2 cytokines by CD8+ lung cells is associated with greater decline in pulmo- nary...

Ngày tải lên: 12/08/2014, 18:21

... of apoptosis/inflammation and fibrosis. The "benignity" of fatty liver is widely accepted but conceptually difficult to maintain because the mechanisms underlying this entity are the same ones ... deposition. Transforming growth factor-beta1 released by hepatic stellate cells during chronic liver injury plays a critical role in liver apoptosis and fibrogenesis. Objective: To...

Ngày tải lên: 18/06/2014, 15:20

... pathophysiology of RSV, though RSV does not appear to directly activate neutrophils in the lower airways. Therefore locally produced cytokines or other molecules released by virally-infected airway ... intensifying screen. Statistical analysis When applicable, statistical significance was assessed by one-way analysis of variance (ANOVA). Differences iden- tified by ANOVA were pinpointed...

Ngày tải lên: 12/08/2014, 14:20

... plasmid. By contrast, activation of PKR by transfection of low amounts of TAR RNA increased frameshifting efficiency by 140%. TAR RNA had no effect on frameshifting after downregulation of PKR by siRNAs in ... interferon-inducible enzymes, 2',5'-oligoadenylate syn- thetase and PKR by human T-cell leukemia virus type I Rex- response element. Virology 1995, 206:913-922. 146....

Ngày tải lên: 13/08/2014, 05:21