Báo cáo y học: "CD8+ T lymphocytes in bronchoalveolar lavage in idiopathic pulmonary fibrosis" ppt

... zdaniil@med.uth.gr * Corresponding author Abstract Background: Recently it was shown that in Idiopathic Pulmonary Fibrosis (IPF) tissue infiltrating CD 8+ T lymphocytes (TLs) are associated with breathlessness ... existing discrepancies on the pathogenetic role of inflammatory cells in IPF patients. Although the current pathogenetic theories in IPF sustain progress despite pauc...

Ngày tải lên: 11/08/2014, 08:21

... needed to sup- port our findings. Competing interests The author(s) declare that they have no competing interests. Authors' contributions ZD participated in the design of the study and collection of ... conten- tion that the type of the inflammatory response may modulate tissue injury, fibrosis or both [3,4]. Animal studies imply that TLs might play a role in the initiation and the e...

Ngày tải lên: 12/08/2014, 18:21

... [3], intermittent double-lung ventilation [4], concomitant use of inhaled nitric oxide and almitrine [5], and pulmonary artery occlusion of the non-ventilated lung using a pulmonary artery catheter ... the ventilated lung may improve oxygenation during the filling phase, although during the drainage phase, it may augment the shunt through the non-ventilated lung. Monitoring of airway pres...

Ngày tải lên: 11/08/2014, 19:21

... S AS TGGGACTGATGCTGGTGA CTGGCTTTGTCTTTCTTGTTATC 376 TGFb1 S AS CCCTGTATTCCGTCTCCTT GCGGTGCTCGCTTTGTA 363 TNFa S AS GGCGGTGCCTATGTCTC GCAGCCTTGTCCCTTGA 383 b-actin S AS CTTCCTTAATGTCACGCACGATTTC GTGGGGCGGCCCAGGCACCA 541 S, ... ilo- prost and bleomycin than those treated with bleomycin without iloprost. Interestingly, we first observed that ilo- prost significantly induced production of IFNg i...

Ngày tải lên: 12/08/2014, 11:21

... recently shown that IFN-a inhibits IL-2 induced proliferation in PHA-activated T- lymphocytes, by abrogating the activation of the cell cycle mac hinery [16]. The present study investi- gates whether ... IL-2 induced Stat5 DNA- binding activity thus partially seem to translate into effects on Stat5 dependent transcription of the IL-2Ra gene. Effects of IFN-a on the PtdIns3K pathway Recent...

Ngày tải lên: 31/03/2014, 15:20

... determined by flow cytometry. The bottom panel depicts mean p24 levels in the vector containing supernatants. The titers and p24 levels were normalized to SEAP activity present in the vector stock. ... packaging system with the1045 nt RRE provided titers higher than one with the 272 nt RRE. Finally, the results showed that a packaging system with 1045 nt SIV RRE achieved titers equal to...

Ngày tải lên: 10/08/2014, 05:21

... We hypothesized that IVIG contributed to activation of HIV-1 in latently-infected cells, leading to a transient increase in plasma viral load, and followed by a decrease in infected T- lymphocytes. These ... adjuvant to effective ART and investigates its potential effect on the latent reservoirs. Our interest in IVIG was prompted by observing the response of an HIV- 1-infected subje...

Ngày tải lên: 10/08/2014, 05:21

... suggesting that the inflammatory process in COPD may resemble that in other disorders where Tc17 cells are active. These findings contribute to the growing body of information that supports the ... -TAGTCCACGTTCC- CATCAGC-3’ ; IL-17F forward: 5’ -GTGCCAGGAGG TAGTATGAAGC-3’; IL-17F reverse: 5’-ATGTCTTCC TTTCCTTGAGCATT-3’ ;GAPDHforward:5’ -AGT- CAACGGATTTGGTCGTATT-3’; GAPDH reverse: 5’- ATG...

Ngày tải lên: 12/08/2014, 13:22

... where they retain their capacity to initiate autoimmune inflammation [2], negative selection in the thymus is not sufficient to prevent the activation of self-reactive T cells in the periphery [3]. Thus, ... selectively recruited to and retained in the rheumatoid joint through interactions involving CXCR4. In line with the hypothesis that CD4 + CD25 + T cells are effectively recru...

Ngày tải lên: 09/08/2014, 06:22

... activity in SLE may be explained by a variability of disease activity in the patients studied. Investigators who reported decreased percentages probably studied patients with chronic, moderately active ... function of these cells was intact in cultures without antigen-presenting cells. The functional activity of both patient and healthy control Tregs, however, was decreased in the pre...

Ngày tải lên: 09/08/2014, 13:22