Báo cáo y học: "Demonstration of a novel technique to quantitatively assess inflammatory mediators and cells in rat knee joints" pps

... 1066. 4. Chang H, Israel H: Analysis of inflammatory mediators in tem- poromandibular joint synovial fluid lavage samples of symp- tomatic patients and asymptomatic controls. J Oral Maxillofac Surg ... animal over a period of up to a day to determine the affect of drugs on the levels of inflammatory mediators, or the acute effect of an inflammatory insult on...

Ngày tải lên: 11/08/2014, 08:21

... project. A wing disc cDNA library derived from fifth instar B. mori C108 larvae was kindly provided by Dr Kawasaki (University of Utsunomiya, Japan). A total of 1000 clones were s elected at random and ... UDP- glycosyltransferase. The UDP-glycosyltransferases ( UGTs) are a superfamily of enzymes that p lay a central role in the detoxication and elimination of a wide ra...

Ngày tải lên: 22/02/2014, 04:20

... min. The efficacy of viral inactivation was examined by a real-time RT-PCR and plaque assay. Expression of the eIF 5A gene in UV-i nac- tivated Den-2 viral-infected C6/36 cells was assayed by a real-time ... originally considered to be a translation initiation factor based on its in vitro activity of stimulating the formation of methionyl-puromycin, a dipeptide anal...

Ngày tải lên: 12/08/2014, 01:21

... CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1411-1575 165 F2-3 TGCAG GGATCCATGAATGACGACCAGTTAGAT GTCGACTTAAGCTAATGGTCCAGTAGA 1531-1731 201 F4 TGCAG GGATCCATGAATGACGACCAGTTAGAT CTTTGGTCGACTTATTCCCCCGGATAATAGAT ... TGCAG GGATCCATGATCTATTATCCGGGGGAA CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1558-1575 18 F13 GATCCATGATCTATTATCCGGGGTAAG TCGACTTACCCCGGATAATAGATCATG 1558-1572 15 F14 GATCCATGTATTATCCGGGGGAATAAG TCGACTTA...

Ngày tải lên: 12/08/2014, 01:21

... and another PCR analysis was performed using the same primers as in the initial analysis. DNA of organs and tissue supernatants was extracted using the QiAamp tissue kit according to the manufacturer's ... Long-dis- tance (LD) PCR using the TaKaRa-Ex PCR system (Takara Bio inc., Otsu, Japan) according to the manufacturer's instructions. An amplification product of appr...

Ngày tải lên: 12/08/2014, 04:21

... Furuichi T, Ikegawa S, Ohmura K, Mimori T, Matsuda F, Iwamoto T, Momohara S, Yamanaka H, Yamada R, Kubo M, Nakamura Y, Yamamoto K: A regulatory variant in CCR6 is associated with rheumatoid arthritis ... inbred strains. The histopathology of the joints and extraarticular organ systems was examined. Serum cytokines and immunoglobulins (Igs) were measured by ELISA and cytometric be...

Ngày tải lên: 12/08/2014, 17:22

... that a ect symptoms of the disease (analgesics) Acetaminophen Relieves pain Aspirin Reduces in ammation and relieves pain Oral nonsteroidal anti -in ammatory drugs (NSAIDs) Diclofenac Reduces ... Atsumi T, Ishihara K, Kamimura D, Ikushima H, Ohtani T, Hirota S, Kobayashi H, Park SJ, Saeki Y, Kitamura Y, Hirano T: A point mutation of Tyr-759 in interleukin 6 family cytokine...

Ngày tải lên: 12/08/2014, 17:22

... The canonical NF-κB pathway is typically activated by inflam- matory cytokines such as TNFα and IL-1, thus playing roles in inflammation as well as in apoptosis. In compar- ison, the non-canonical ... Gastroenterology and Hepatology, Niigata University Graduate School of Medical and Dental Sciences, 1-757 Asahimachi- Dori, Niigata 951-8510, Japan and 3 Department of Immunol...

Ngày tải lên: 12/08/2014, 23:22

... HXB2-43E (5' ACA GAG ATG GAA GAG GAA GGG AAA A- 3', nucle- otides 2664–2688), 43E-RT (5' ACA GAG CTG GAA GAG GAA GGG AAA A- 3', nucleotides 2664–2688) and 43E- RTA (5' ACA TTT ... and thus cannot apparently directly influence ATP binding [41]. Rather M41L may have a more indirect effect on ATP binding perhaps via alteration of van der Waals contacts with F11...

Ngày tải lên: 13/08/2014, 06:20

... in 24-well plates already containing compounds and chemokines at varying con- centrations (1/5 dilutions). SCH-C and AMD3100 were evaluated as single agents or as a mixture of both at a 1:1 ratio. ... original virus input was washed away and fresh DMEM-based medium was added (con- taining antagonists at the same concentrations as before). The cytopathic effect (syncytium or gian...

Ngày tải lên: 13/08/2014, 13:20