Báo cáo y học: " Early Anti-inflammatory and anti-arthritic effects of yucca schidigera: A review" pdf
Báo cáo y học: "Anti-inflammatory and antiarthritic effects of piperine in human interleukin 1β-stimulated fibroblast-like synoviocytes and in rat arthritis models" pps
... rat models of paw edema and arthritic ankleAnalgesic and antiarthritic effects of piperine in rat models of paw edema and arthritic ankle. (a) Piperine showed analgesic effects in carrageenan- induced ... Newman RA, Aggarwal BB: Bioa- vailability of curcumin: problems and promises. Mol Pharm 2007, 4:807-818. 19. Iwashita M, Saito M, Yamaguchi Y, Takagaki R, Nakahata N: In...
Ngày tải lên: 09/08/2014, 14:20
Báo cáo y học: " Early Anti-inflammatory and anti-arthritic effects of yucca schidigera: A review" pdf
... chemistry and bioactivity of yucca saponins and phe- nolics have recently been reviewed by Piacente et al. [21]. Anti-arthritic effects of yucca Yucca products have been used for many years for ... wo@sybilla.iung.pulawy.pl * Corresponding author Abstract Yucca schidigera is a medicinal plant native to Mexico. According to folk medicine, yucca extracts have anti-arthri...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: "Early biomarkers and potential mediators of ventilation-induced lung injury in very preterm lambs" ppt
... CTGTGAGAGGAGGTGGAGAG IL-6 NM_001009392 598–705 CGCAAAGGTTATCATCATCC CCCAGGAACTACCACAATCA IL-8 NM_001009401 438–520 CCTCAGTAAAGATGCCAATGA TGACAACCCTACACCAGACC 18S X01117 1495–1673 GTCTGTGATGCCCTTAGATGTC ... GCAGCTGAAGTCAAAGGAA CTGF DQ239672 407–469 TATAGCTCCAGCGACAGCTC ACGAACTTGACTCAGCCTCA CYR61 DQ239628 286–354 ATCGTCCAAACAACTTCGTG GGTAACGCGTGTGGAGATAC IL-1 NM_001009465 353–473 CGATGAGCTTCTGT...
Ngày tải lên: 12/08/2014, 14:20
Báo cáo y học: "Anti-inflammatory and arthritic effects of thiacremonone, a novel sulfurcompound isolated from garlic via inhibition of NF-κB" pptx
... and cyclooxygenase-2. Br J Pharmacol 2009, 156:328-337. 39. Sugishita E, Amagaya S, Ogihara Y: Anti-inflammatory testing methods: comparative evaluation of mice and rats. J Pharmacobiodyn 1981, ... anti-inflammatory and anti-arthritic property of thiacre- monone was tested in male SD rats using the carrageenan paw edema test according to the method of Sugishita and collea...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Annotating conserved and novel features of primate transcriptomes using sequencing" pdf
... University of California Santa Cruz (UCSC) Genome Browser, the Vega Genome Browser and an integrated database of human genes and trans- cripts (H-Invitational Database): one finds an average overlap ... blueprint of a phenotype, but rather a well-scrambled message, in which functionally relevant sequences are lost in a sea of phenotypically neutral information. A seemi...
Ngày tải lên: 09/08/2014, 20:22
Báo cáo y học: "Modeling antibiotic and cytotoxic effects of the dimeric isoquinoline IQ-143 on metabolism and its regulation in Staphylococcus aureu" pot
... were calculated applying YANA [21]. Changes in reactions and enzyme activity of S. aureus and S. epidermidis after administration of IQ-143 Using the above experimental data and the two strain- specific ... only Primary metabolism TCA cycle & oxidative phosphorylation & pentose phosphate pathway Glycolysis Amino acid metabolism: all 20 amino acids Fatty acid metabolism: beta...
Ngày tải lên: 09/08/2014, 22:24
Báo cáo y học: "Combined adenocarcinoid and mucinous cystadenoma of the appendix: a case report" pdf
... classical carcinoids to plan treatment [13]. A meta-analysis of retrospective chart reviews by Varisco et al. evaluated the efficacy of appendi- cectomy versus hemicolectomy for localized adenocarci- noids. ... a radical right hemicolectomy with clear margins and lymph nodes. Conclusion: Adenocarcinoids account for 2% of primary appendiceal malignancies. Most tumours are less than...
Ngày tải lên: 11/08/2014, 19:21
Báo cáo y học: "Relative effectiveness and adverse effects of cervical manipulation, mobilisation and the activator instrument in patients with sub-acute non-specific neck pain: results from a stopped " ppt
... Therapy and Clinical Application. Austin, Pro-Ed 2001. 91. McPartlan JM, Simons DG: Myofascial trigger points: Translating molecular theory into manual therapy. J Manual Manipulative Therapy ... pain intensity. Participants also kept a diary of any pain medication taken and noted any perceived adverse effects of treatment. Outcomes were measured at four points: end of treatm...
Ngày tải lên: 13/08/2014, 14:20
Báo cáo khoa học: " Monocarboxylate Transporters and Lactate Metabolism in Equine Athletes: A Review" pdf
... Samples for the measurement of whole blood lactate and plasma lac- tate were taken about 5 min after a 2100-m race. The sample for plasma lactate analysis was immediately cooled in ice-water and ... From a practical point of view, knowledge of aerobic capacity is valuable, because high capacity would mean that lactate concentration for a ma- jor part of the race will be lowe...
Ngày tải lên: 12/08/2014, 15:20
Báo cáo y học: "Cellular mechanisms underlying the effects of an early experience on cognitive abilities and affective states." ppt
... a chronic forced swimming stress, were measured by radioimmunoassay (RIA). Data were statistically analyzed by analysis of variance (ANOVA). Results: Neonatal handling increased the ability of ... Psychiatry Open Access Primary research Cellular mechanisms underlying the effects of an early experience on cognitive abilities and affective states Efstathios Garoflos † , Theofanis...
Ngày tải lên: 08/08/2014, 21:20