Báo cáo y học: "CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis" pptx
Báo cáo y học: "CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis" pptx
... this article as: Bhagawati-Prasad et al.: CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis. Journal of Immune Based Therapies and Vaccines ... Efficacy of human papillomavirus (HPV)-16/18 AS04-adjuvanted vaccine against cervical infection and precancer caused by oncogenic HPV types (PATRICIA): final analysis of a...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: " IL-13 induces a bronchial epithelial phenotype that is profibrotic" ppt
... time point. Data are reported as mean ± SD and InStat 2.01 for Macintosh software package was used for all analysis. Data were analyzed using one-way analysis of variance (ANOVA) with Student Newman ... changes in the airways that have been termed 'airway remodeling'. These structural changes include epithelial damage, goblet cell metaplasia in the airway epithelium, subepithe...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo y học: " Chlamydophila pneumoniae induces a sustained airway hyperresponsiveness and inflammation in mice" potx
... These data indicate that C. pneumoniae infection induces a sustained airway hyperresponsiveness. Airway inflammation To assess whether C. pneumoniae infection induces a change of the inflammatory ... [12,35-37]. Atypical pathogen persistent infection may participate in airway inflammation. Chlamydial infection activates a cytokine response including basic fibroblast growth f...
Ngày tải lên: 12/08/2014, 15:21
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"
... (5’→3’) Anticipated length (bp) D-Loop ATTCTAACCTGAATCGGAGG GATGCTTGCATGTGTAATCT 1528 ATPase8 CCCGGACGTCTAAACCAAACC GGGGATCAATAGAGGGGGAAATA 512 ATPase6 AATTACCCCCATACTCCTTACACT GGGTCATGGGCTGGGTTTTACTAT ... GGGTCATGGGCTGGGTTTTACTAT 857 COX-I CCTCGGAGCTGGTAAAAA GGGGGTTCGATTCCTTC 1654 COX-II ACTACCCCGATGCATACACCACA GGGCAATGAATGAAGCGAACAG 1333 COX-III GCCGTACGCCTAACCGCTAACA TCGTAAGGGGTGGTTT...
Ngày tải lên: 25/10/2012, 11:18
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt
... laboratories have indicated that glyceraldehyde- 3-phosphate dehydrogenase (Gra3P DH; EC 1.2.1.12), an important enzyme of the glycolytic pathway, may play a primary role in the high aerobic glycolysis ... (EAC) cell, a highly dedifferentiated and rapidly growing malignant cell and partially characterized the enzyme [10]. Preliminary results have indicated that structural and cata...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo y học: "Candida albicans induces cyclo-oxygenase 2 expression and prostaglandin E2 production in synovial fibroblasts through an extracellular-regulated kinase 1/2 dependent pathway" pps
... by macrophages in response to zymosan and C. albicans infection [43]. In the cur- rent study laminarin partially blocked the increase in COX-2 mRNA that is seen when synovial fibroblasts are infected ... C. albicans infection of synovial fibroblasts in vitro results in upregulation of cyclo-oxygenase 2 and prostaglandin E2 by mechanisms that may involve activation of extrace...
Ngày tải lên: 09/08/2014, 14:20
Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx
... contamination during sample prep- aration for post-PCR analysis. Real-time RT-PCR assays have been widely utilized for early diagnosis of many other animal viral diseases [7,8]. In this study a ... completes amplification and analysis in a closed system, has many advantages over conventional RT-PCR methods: lower chance of contamination, allows quantitative measure- ment of RNA, more...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo y học: "Treatment with apolipoprotein A-1 mimetic peptide reduces lupus-like manifestations in a murine lupus model of accelerated atherosclerosis" ppt
... 12:R93 http://arthritis-research.com/content/12/3/R93 Page 12 of 13 Competing interests Mohamad Navab and Alan M. Fogelman are principals in Bruin Pharma and Alan M. Fogelman is an officer in Bruin Pharma. The remaining authors have no competing ... mice was analyzed for 69 chemokines and cytokines using Luminex-based beadarray. L-4F treatment resulted in a trend toward decreased lev...
Ngày tải lên: 12/08/2014, 12:20
Báo cáo y học: " Recently published papers: A clinical conundrum, new from old and advances in ventilation'''' docx
... group was also shown. An equally unappetizing prospect is the combination of ARF and haematological malignancy. A further study appearing in Chest [14] compared NIV with invasive intubation and ventilation ... with some clinicians suggesting that immobilization should be indefinite until clinical examination could be carried out in the awake patient. Based upon a literature revi...
Ngày tải lên: 12/08/2014, 20:21
Báo cáo y học: "Fluid balance as a biomarker: impact of fluid overload on outcome in critically ill patients with acute kidney injury" potx
... counterbalance fluid accumulation, particularly in those with oliguria or AKI. Timing is crucial, and RRT should ideally be initiated as early and safely as possible [19]. As a minimum, all critically ... compelling evidence that attention to fluid balance and prevention of volume overload, in particular in AKI, may be an important and under- appreciated determinant of surviva...
Ngày tải lên: 13/08/2014, 11:22