Báo cáo y học: "CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis" pptx
Báo cáo y học: "CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis" pptx
... this article as: Bhagawati-Prasad et al.: CD40mAb adjuvant induces a rapid antibody response that may be beneficial in post-exposure prophylaxis. Journal of Immune Based Therapies and Vaccines ... Efficacy of human papillomavirus(HPV)-16/18 AS04-adjuvanted vaccine against cervical infection andprecancer caused by oncogenic HPV types (PATRICIA): final analysis of a double-blind, randomised ... the final manuscript.Competing interestsAH is a Director of Adjuvantix Ltd and also holds some stock in Adjuvantix.Adjuvantix Ltd have an interest in CD40mAb based immunologicaladjuvants.Received:...
- 3
- 245
- 0
Báo cáo y học: " IL-13 induces a bronchial epithelial phenotype that is profibrotic" ppt
... timepoint. Data are reported as mean ± SD and InStat 2.01 forMacintosh software package was used for all analysis.Data were analyzed using one-way analysis of variance(ANOVA) with Student Newman ... changes in the airways that have been termed 'airway remodeling'. These structuralchanges include epithelial damage, goblet cell metaplasia in the airway epithelium, subepithelial ... treatment and 1 daywithdrawal of IL-13 containing media) and day 28 (i.e. 14day treatment and 7 day withdrawal of IL-13 media), theNHBE were fixed using 4% formaldehyde (Sigma) in PBSat 4°C...
- 12
- 198
- 0
Báo cáo y học: " Chlamydophila pneumoniae induces a sustained airway hyperresponsiveness and inflammation in mice" potx
... These data indicate that C. pneumoniae infection induces a sustained airway hyperresponsiveness.Airway inflammationTo assess whether C. pneumoniae infection induces a change of the inflammatory ... [12,35-37].Atypical pathogen persistent infection may participate in airway inflammation. Chlamydial infection activates a cytokine response including basic fibroblast growth factor[38] by smooth ... pneumotachograph in the top of the plethysmo-graph. An aerosol inlet to the animal chamber was centri-cally located in the roof of the animal chamber. When ananimal was placed in the animal chamber...
- 9
- 283
- 0
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"
... (5’→3’) Anticipated length (bp) D-Loop ATTCTAACCTGAATCGGAGG GATGCTTGCATGTGTAATCT 1528 ATPase8 CCCGGACGTCTAAACCAAACC GGGGATCAATAGAGGGGGAAATA 512 ATPase6 AATTACCCCCATACTCCTTACACT GGGTCATGGGCTGGGTTTTACTAT ... GGGTCATGGGCTGGGTTTTACTAT 857 COX-I CCTCGGAGCTGGTAAAAA GGGGGTTCGATTCCTTC 1654 COX-II ACTACCCCGATGCATACACCACA GGGCAATGAATGAAGCGAACAG 1333 COX-III GCCGTACGCCTAACCGCTAACA TCGTAAGGGGTGGTTTTTCTATG 1177 Cyt b CGCACGGACTACAACCACGAC ... (Shanghai Shenkai Gas Co., Ltd. China), anti-CagA and anti-VacA polyclonal antibodies (Santa Cruz, USA), AP conjugate d sec-ondary antibody, CellTiter-Glo luminescent cell via-bility assay...
- 12
- 557
- 2
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt
... laboratories have indicated that glyceraldehyde-3-phosphate dehydrogenase (Gra3P DH; EC 1.2.1.12), animportant enzyme of the glycolytic pathway, may play a primary role in the high aerobic glycolysis ... (EAC) cell, a highly dedifferentiated and rapidly growing malignant celland partially characterized the enzyme [10]. Preliminaryresults have indicated that structural and catalytic propertiesof ... observations suggest that Gra3P DH ofmalignant cells may be modified and that methylglyoxal may act at this modified site. To investigate this, we purifiedGra3P DH from Ehrlich ascites carcinoma (EAC)...
- 8
- 283
- 0
Báo cáo y học: "Candida albicans induces cyclo-oxygenase 2 expression and prostaglandin E2 production in synovial fibroblasts through an extracellular-regulated kinase 1/2 dependent pathway" pps
... by macrophages in response to zymosan and C. albicans infection [43]. In the cur-rent study laminarin partially blocked the increase in COX-2mRNA that is seen when synovial fibroblasts are infected ... C. albicans infection of synovial fibroblasts in vitroresults in upregulation of cyclo-oxygenase 2 and prostaglandinE2 by mechanisms that may involve activation of extracellular-regulated kinase ... Kojima F, Naraba H, Miyamoto S, Beppu M, Aoki H, Kawai S:Membrane-associated prostaglandin E synthase-1 is upregu-lated by proinflammatory cytokines in chondrocytes frompatients with osteoarthritis....
- 9
- 403
- 0
Báo cáo y học: " The development of a rapid SYBR one step real-time RT-PCR for detection of porcine reproductive and respiratory syndrome virus" potx
... contamination during sample prep-aration for post-PCR analysis. Real-time RT-PCR assayshave been widely utilized for early diagnosis of manyother animal viral diseases [7,8]. In this study a ... completesamplification and analysis in a closed system, has manyadvantages over conventional RT-PCR methods: lowerchance of contamination, allows quantitative measure-ment of RNA, more rapid to ... Biology, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, Gansu730046, ChinaFull list of author information is available at the end of the articleTian...
- 7
- 350
- 0
Báo cáo y học: "Treatment with apolipoprotein A-1 mimetic peptide reduces lupus-like manifestations in a murine lupus model of accelerated atherosclerosis" ppt
... 12:R93http://arthritis-research.com/content/12/3/R93Page 12 of 13Competing interestsMohamad Navab and Alan M. Fogelman are principals in Bruin Pharma andAlan M. Fogelman is an officer in Bruin Pharma. The remaining authors have nocompeting ... mice wasanalyzed for 69 chemokines and cytokines usingLuminex-based beadarray. L-4F treatment resulted in a trend toward decreased levels of tissue damage andinflammation indicators, including ... University of California, LosAngeles Animal Research Committee.Autoantibody analysis using enzyme-linked immunosorbant assay (ELISA)Serum and plasma samples were collected from eachmouse at euthanasia....
- 13
- 360
- 0
Báo cáo y học: " Recently published papers: A clinical conundrum, new from old and advances in ventilation'''' docx
... group was also shown.An equally unappetizing prospect is the combination of ARFand haematological malignancy. A further study appearing in Chest [14] compared NIV with invasive intubation andventilation ... with some clinicianssuggesting that immobilization should be indefinite untilclinical examination could be carried out in the awake patient.Based upon a literature review and available consensus, ... However, these findings were largely based on 28-daydata, and as such they do not take the entire hospital stayinto account. Laterre and coworkers point out that, at28 days, more than 40% of the...
- 4
- 236
- 0
Báo cáo y học: "Fluid balance as a biomarker: impact of fluid overload on outcome in critically ill patients with acute kidney injury" potx
... counterbalance fluidaccumulation, particularly in those with oliguria or AKI.Timing is crucial, and RRT should ideally be initiated as earlyand safely as possible [19]. As a minimum, all critically ... compelling evidence that attention to fluid balance and prevention of volumeoverload, in particular in AKI, may be an important and under-appreciated determinant of survival.These data encourage ... resuscitative management has been accomplished.Few clinical investigations, until now, have evaluated theimpact that fluid balance has on clinical outcomes in criticallyill adults with AKI [1]. In...
- 3
- 270
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học số loài quý hiếm tại vườn quốc gia ba bểbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM