Báo cáo khoa hoc:" A critique of the WHO TobReg''''''''s "Advisory Note" report entitled: "Waterpipe tobacco smoking: health effects, research needs and recommended actions by regulators" ppt
Báo cáo khoa hoc:" A critique of the WHO TobReg''''s "Advisory Note" report entitled: "Waterpipe tobacco smoking: health effects, research needs and recommended actions by regulators" ppt
... report entitled: "Waterpipe tobacco smoking: health effects, research needs and recommended actions by regulators" Kamal Chaouachi* Address: Researcher in Socio-Anthropology and Tobaccology, ... this unsubstantiated belief. For example, the label of a popular waterpipe tobacco brand sold in South-West Asia and North America states '0.5 nicot...
Ngày tải lên: 11/08/2014, 08:20
Tài liệu Báo cáo khoa học: Homologous expression of the nrdF gene of Corynebacterium ammoniagenes strain ATCC 6872 generates a manganese-metallocofactor (R2F) and a stable tyrosyl radical (Y•) involved in ribonucleotide reduction ppt
... Clara, CA, USA). Data acquisition was performed using the Bruker software, as described above. Analysis of metals Manganese and iron have been determined by GF-AAS and ICP-MS. [As a result of ... cannot, however, explain the remarkably broad wings of the signal. The broad lineshape and the enhanced relaxa- tion properties of the signal at 77 K indicate that the...
Ngày tải lên: 15/02/2014, 01:20
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
... extracellular matrix, it seems more likely that the SEA domain functions by orienting the active site cleft of DESC1 toward plasma and ⁄ or extracellular spaces and away from the cell surface and ⁄ or the ... Marathon-Ready cDNA (Clontech, Moun- tain View, CA, USA). Two fragments were isolated and confirmed by Southern analysis using the internal cDNA fragment as the...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: Crystal structure of the BcZBP, a zinc-binding protein from Bacillus cereus doc
... Ivanova N, Sorokin A, Anderson I, Galleron N, Candelon B, Kapatral V, Bhattacharyya A, Reznik G, Mikhailova N, Lapidus A et al. (2003) Genome sequence of Bacillus cereus and comparative analysis with ... three-stranded b-sheets, each one consisting of the antiparallel b-strands b6, b7 of one monomer and strand-b8 of the other. Solvent-accessible surface [15] calculations s...
Ngày tải lên: 19/02/2014, 00:20
Báo cáo khoa học: Novel repressor of the human FMR1 gene ) identification ¨ of p56 human (GCC)n-binding protein as a Kruppel-like transcription factor ZF5 ppt
... general rules for siRNA selection [43]. The first siRNA ZF5 5¢-GGUUGAGGAUGUGAAAUUCUU-3¢ and 5¢-GAAUUUCACAUCCUCAACCUU-3¢) matched bases 192–210; the second siRNA ZF5 (5¢-GAGGAAGCAUGA GAAACUCUU-3¢ and ... Health of the Russian Federation. The first pair of primers (5¢-GGCCTTCAAGGCATTAAG-3¢,5¢-AAACAAATGG CCTGTCCG-3¢) spanned a 958 bp 5¢-part of the ZF5 coding region; the...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Mathematical modelling of the urea cycle A numerical investigation into substrate channelling docx
... high-flux pathway. Acknowledgements This work was supported by a grant from the Australian National Health and Medical Research Council and the Australian Research Council to P. W. Kuchel. A. D. Maher ... Mathematically this was achieved by introducing a Ôfree mixing factorÕ ( fm) to the rate equation for exogenous arginine hydrolysis by arginase in the Mathematica...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo khoa học: Molecular cloning of the Matrix Gla Protein gene from Xenopus laevis Functional analysis of the promoter identifies a calcium sensitive region required for basal activity doc
... 5¢-CG GGATCCCAATCTGTTGCTAA TTAGG-3¢)andthe3¢ specific oligonucleotides (5¢-GA AGATCTACCACACCTCCTCATCTCC-3¢) for ampli- fication of the region from )180 to )36 and (5¢-GA AGAT CTAACTAGATTTTACCATTGG-3¢) for amplification of the region ... three copies of double stranded oligonucleotides spanning the region from )70 to )36 of t he xMGP promoter (5¢-GATCCAGGGGAGGGAAAACAAGGA GATGAGGAG...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
... such as dynamin and the antiviral protein, Mx. Because of similarities in the molecular architecture of GBPs and members of the dynamin family, GBPs are classified as a part of the dynamin superfamily. ... we analysed the enzymatic activity of hGBP 5a ⁄ b and hGBP5ta in a concentration-dependent manner. Various concentrations of purified hGBP 5a ⁄ b and hGBP5...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo khoa học: Systemic RNAi of the cockroach vitellogenin receptor results in a phenotype similar to that of the Drosophila yolkless mutant ppt
... different developmental stages using the General Elute Mammalian TotalRNA kit (Sigma, Madrid, Spain). A 300 ng portion of each RNA extraction was DNAse treated (Promega, Madi- son, WI, USA) and reverse transcribed ... adjuvant, and used to boost New Zealand female rabbits. The resulting antibody recognized a band that fit with the predicted size of BgVgR (202 kDa). The anti...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
... sequence of Thermoplasma volcanium. Proc.NatlAcad.Sci.USA97, 14257–14262. 49. Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Hai- kawa,Y.,Jin-n.,o,K.,Takahashi,M.,Sekine,M.,Baba,S., Ankai, A. , ... irradi- ation and then resolved by SDS/PAGE in 12% p olyacrylamide gel and visualized by radioautography. (A) Lanes 1 and 2, pH 8.0 at 60 °Cand 70 °C; lanes 3 and 4, pH 10.0...
Ngày tải lên: 16/03/2014, 16:20