Báo cáo khoa hoc:" The "Statinth" wonder of the world: a panacea for all illnesses or a bubble about to burst" pps

... world: a panacea for all illnesses or a bubble about to burst Nusrat Shafiq 1 , Samir Malhotra* 1 , Promila Pandhi 1 and Anil Grover 2 Address: 1 Department of Pharmacology, Post Graduate Institute ... pre- existing CAD. Collaborative Atorvastatin Diabetes Study (CARDS) was carried out to evaluate the efficacy and safety of low-dose atorvastatin treatment in pr...

Ngày tải lên: 11/08/2014, 08:20

... Tests for Bacteria that Grow Aerobically; Approved Standard. Wayne, Pennsylvania, USA: Clinical and Laboratory Standards Institute;, 7 2006. 17. Clinical and Laboratory Standards Institute: Performance ... Woodward D, Ahmed R, Clark C, Tabor H, Dore K, Ciampa N, Muckle A: Laboratory Surveillance Data for Enteric Pathogens in Canada: Annual Summary 2006. Winnipeg, Manitoba, Canada: Public...

Ngày tải lên: 11/08/2014, 14:21

... or intramolecular interactions, allowing access to the AD. As the autoinhibition affected an unrelated AD when this was put in place of the native Meis2d AD, it appears that any intramolecular ... contain an nuclear localization signal within the GBD part of the protein. Another possible explanation for the observed autoinhibitory activity is that the Hth domain mediat...

Ngày tải lên: 16/02/2014, 15:20

... by the average activity of mutants in the central domain of 26% for WAF1 and 34% for MDM2, 71% for NOXA and 61% for p53R2, and around 45% for the other four promot- ers. For some specific mutants, ... [4–7]. The major drawback of these analyses is the lack of information regarding the activity or loss of activity of the target protein, as only a few va...

Ngày tải lên: 18/02/2014, 11:20

... (5¢-GCT ACA ATA GCA CAC TAT ATT AAA CGG CAA AGC CGT AAA ACC CC G TGT AGG CTG GAG CTG CTT CG- 3¢) and rluD114::cat(pKD3) 3¢ (5¢-GAC CAG ATT AAT GTG AAA AGA AAA TCA CGC GTA CCG GAT CGT CTT G AT GGG AAT ... belongs to the RluA family [2]. Binding of RluA to one of its substrates, tRNA Phe anticodon stem-loop, induces reorganization of the RNA [21]. An ability of the RNA substra...

Ngày tải lên: 18/02/2014, 16:20

... in a fully activated form. The Arg316 fi Ala and Glu275 fi Ala substi- tutions appear to damage intrinsically the activation conformation to a level that BPA is unable to rescue completely. It was ... for Arg316 fi Ala, aag for Arg316 fi Lys, ctg for Arg316 fi Leu, and gag for Arg316 fi Glu). Each mutant LBD or full-length ERRc was amplified and cloned into the vector pGEX-...

Ngày tải lên: 18/02/2014, 16:20

... CTAGCTAGCCCTGAAAGTAAGGAAAAAATGAAGAC (R) CCGCTCGAGATGATCCATCAATTCATCTTTATCTTG 5 (F) GGAATTCCATATGAGTGATAAAAACGCTAACGTC (R) CTAGCTAGCCATGTTTTTCATTCCTTCACTAGC 11 (F) GGAATTCCATATGCAGAGTGATAAAAACGCTAACGTCT (R) ... CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC 16 (F) GGAATTCCATATGCAGAATACAGACCAACAAAAAGTGAG (R) CCGCTCGAGCGGCTATCTATCTACTCCTTCTTATGCCCCGCC newpetTOP CTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATAAG...

Ngày tải lên: 19/02/2014, 00:20

... binding sites of polyanions, are important for stabil- ization of the native conformation; the mutants investigated, in fact, all show an increased amount of the misligated H–Fe(III)–H state and, with respect ... A obs is the absorbance at a given wavelength and at a given time interval, A ¥ is the absorbance at longer time intervals (when the reaction is complet...

Ngày tải lên: 19/02/2014, 05:20

... (b) the less active isoform (SP or QAE2) can then adsorb to the ‘open space’ between the prebound AFPs of the ice crystal surface; (c) most of the nfeAFP isoforms adsorb to the growth-terminated ... 2), and indeed is more soluble than the QAE isoform (data not shown). Hence, a plausible explanation for the sub- stantial content of the SP isoform is as follows...

Ngày tải lên: 19/02/2014, 16:20

... et al. (2006), have specifically targeted the discovery of part-whole relations from text. Furthermore, part-whole relations are de-facto benchmarks for evaluating the performance of general relation ... sub-categorize. Part-whole relations are also crucial for many in- formation extraction (IE) tasks (Girju et al., 2006). Annotated corpora and semantic dictionaries used in IE, suc...

Ngày tải lên: 20/02/2014, 04:20