Báo cáo khoa hoc:" The Drosophila Anion Exchanger (DAE) lacks a detectable interaction with the spectrin cytoskeleton" pdf
Báo cáo khoa hoc:" The Drosophila Anion Exchanger (DAE) lacks a detectable interaction with the spectrin cytoskeleton" pdf
... the basal surface of the plasma membrane (Figure 4A& amp;4H). In contrast, α spectrin was abundant at lateral sites of cell-cell contact as well as at the basal plasma membrane (Figure 4G). Faint ... original work is properly cited. Research The Drosophila Anion Exchanger (DAE) lacks a detectable interaction with the spectrin cytoskeleton Ronald R Dubreuil*...
Ngày tải lên: 11/08/2014, 07:21
Báo cáo khoa học: "Immunolocalization of anion exchanger 1 (Band 3) in the renal collecting duct of the common marmoset" pptx
... demonstrated that band 3 is expressed in the basolateral plasma mem- branes of type A intercalated cells and has a role in the acid-base balance in the marmoset kidney. In summary, band 3 in the ... H + -ATPase-positive intercalated cells. Arrowheads, type A intercalated cells with basolateral band 3 an d apical H + -ATPase in the CNT, CCD, and OMCD. Arrows, type B interc...
Ngày tải lên: 07/08/2014, 20:23
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf
... properties. The kinetic para- meters of the PA-catalysed hydrolysis of the studied phenylacetyl arylamides are compared in Table 2. The substrates are arranged in a decreasing order of the ratio of their ... of the tetrahedral intermediate. Experimental data [21] for the efficient hydrolysis of NIPAB catalysed by the ArgB263Lys mutant PA and the lack of hydrolytic activity...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Identification of three proteins that associate in vitro with the Leishmania (Leishmania) amazonensis G-rich telomeric strand pdf
... 5¢- GTAATACGACTCACTATAGGG-3¢ TS 5¢- AATCCGTCGAGCAGAGTT-3¢ OvhF 5¢- CTGGCCGTCGTTTTACTTAGGGTTAGGGTT AGG -3¢ OvhR 5¢- GTAAAACGACGGCCAG-3¢ CSB1 5¢- GTACAGTGTACAGTGTACAGT-3¢ 5¢ biotinTel6 5¢ biotin- GTAATACGACTCGTTAGGGTTAGGGT TAGG -3¢ 3052 ... 5¢- GGTTAGGGTTAGGGTTAG-3¢ Tel6 5¢-GTTAGGGTTAGGGTTAGG-3¢ Tel6-Rev 5¢- CCTAACCCTAACCCTAAC-3¢ Tel6RNA 5¢- GUUAGGGUUAGGGUUAGG-3¢ Tet-tel 5¢- GTTGGGGTTGGGGTTGG-3...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx
... neurons are found (Fig. 1A) , a smaller number of these neurons are scattered in the pontine raphe nucleus, the periaqu- eductal gray matter, and the area dorsal to the substantia nigra in the midbrain ... hippocampus, lateral hypothalamic area (LH) and intergeniculate leaflet of the thalamus (Fig. 1B). Ultrastructural examination revealed that relaxin-3 was localized to the de...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo khoa học: "Smaller Alignment Models for Better Translations: Unsupervised Word Alignment with the 0" potx
... text with manually-aligned parallel text (Moore, 2005; Taskar et al., 2005; Riesa and Marcu, 2010). Although manually-aligned data is very valuable, it is only available for a small number of language pairs. ... the following parallel data: • Chinese-English: selected data from the con- strained task of the NIST 2009 Open MT Eval- uation. 3 • Arabic-English: all available data for...
Ngày tải lên: 30/03/2014, 17:20
Báo cáo khoa học: Myocyte enhancer factor 2 (MEF2) is a key modulator of the expression of the prothoracicotropic hormone gene in the silkworm, Bombyx mori ppt
... images. An area adjacent to the area of interest (A) and an area from an image lacking a spe- cimen (N) were scanned as the background signals. When PTPCs were not visible, the focal plane was adjusted ... integu- ment and muscle at both larval and pupal stages (Fig. 4A, lanes 9 and 15) as well as in the fat body at the pupal stage (Fig. 4A, lane 12). The PTTH mRNA was exclusive...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: "Gamma knife radiosurgery for movement disorders: a concise review of the literature" ppsx
... Ohye C, Shibazaki T, Ishihara J, Zhang J: Evaluation of gamma thalamotomy for parkinsonian and other tremors: survival of neurons adjacent to the thalamic lesion after gamma thalamotomy. J Neurosurg ... unqualified candidates for the neurosurgical alternatives. Also, we advise that patients with bradykinesia, rigidity, and dyskinesia be educated about the variability in the liter...
Ngày tải lên: 09/08/2014, 03:21
báo cáo khoa học: "Components of prolificacy in hyperprolific Large White sows compared with the Meishan and Large White breeds" ppsx
... Conclusion Although the number of data is low, these results show clearly that the 2 prolific genotypes compared are characterized by a different balance between ovulation rate and ... ovulation rate (OR) was calculated by the following analysis of covariance models The age at puberty, ovulation rate at 1st and 3rd oestrus of daughters of...
Ngày tải lên: 09/08/2014, 22:22
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
... Ottawa, K1Z 8R1, Ontario Email: Anita Kothari* - akothari@uwo.ca; Nancy Edwards - nedwards@uottawa.ca; Nadia Hamel - NadiaH@uottawa.ca; Maria Judd - maria.judd@chsrf.ca * Corresponding author ... Smyth Road, Ottawa, Ontario, K1H 8M5, Canada , 3 University of Ottawa, 1 Stewart Street, Ottawa, Ontario, K1N 6N5, Canada and 4 Canadian Health Services Research Foundation, 1565 Carling Avenue,...
Ngày tải lên: 11/08/2014, 16:20