Báo cáo khoa hoc:" Evaluation of vardenafil for the treatment of subjective tinnitus: a controlled pilot study" ppt

... Providence Healthcare, Vancouver, British Columbia, Canada 3 University of California at San Diego, California, USA 4 Centre for Clinical Epidemiology and Evaluation, Vancouver Coastal Health Research ... or unclear from a particular trial, we attempted to contact the primary author of that study. Statistical analysis Meta-analysis was performed using the inverse variance method....

Ngày tải lên: 12/08/2014, 23:22

... to the objective measures used. Abbreviations AE(s): adverse event(s); AICA: anterior inferior cerebellar artery; ALT: alanine aminotransferase; ANCOVA: analysis of covariance; AST: aspartate aminotransferase; ... http://www.jnrbm.com/content/8/1/3 Page 5 of 12 (page number not for citation purposes) of covariance (ANCOVA) with baseline as covariate and the LOCF value as dependent...

Ngày tải lên: 11/08/2014, 07:21

... showed delays in contacting and initiating tre atment among patients ref erred by the study. Care managers initiated patient contact an average of 47 days after referral among randomized evaluation patients, ... PDSA cycle and the end date of the randomized evaluatio n. Recorded data included whether the patient had been naturalistically referred or referred as part of the r...

Ngày tải lên: 10/08/2014, 11:20

... provides a clear explanation for the inability of P450scc to cleave the side chain of vitamin D3. Hydroxylation of the side chain of cholesterol at the adjacent carbons C22 and C20, to produce 2 0a, 22R-dihydroxycholesterol ... synthesis by the human placenta. Placenta 26, 273–281. 2 Guryev O, Carvalho RA, Usanov S, Gilep A & Esta- brook RW (2003) A pathway for...

Ngày tải lên: 18/02/2014, 17:20

... used for the evaluation of the candidate string, and the amount of information that various context carries. We said that for this prototype we considered the adjectives, nouns and verbs that ... of the European Chapter of the Asso- ciation for Computational Linguistics, EACL-94, pages 34-40. B~atrice Daille, I~ric Gaussier and Jean-Marc Lang,. 1994. Towards...

Ngày tải lên: 22/02/2014, 03:20

... was amplified from E. coli K12 genomic DNA, includ- ing a C-terminal HA tag, using primers 5¢-GCGCGCGA ATTCATGAGCATTATTAAAGAATTTCG-3¢ (forward) and 5¢-CGCGCGGGATCCTTAAGCATAATCAGGAAC ATCATAAGGATAACCACCAGGAGAGCGGTTATTC TGCTCTTTC-3¢ ... were 5¢-AGCAGAATAA CTGCTCTCCTGGTG-3¢ (forward) and 5¢-CACCAGGAG AGCAGTTATTCTGCT-3¢ (reverse), and those for MscL F54C were 5¢-GGGATCGATTGCAAACAGTTTGC-3¢ (forw...

Ngày tải lên: 07/03/2014, 02:20

... conversation. As we allow a dynamic change of language during the progress of any dialogue, our architecture must deal with the dynamic activation and deactivation of these resources for a particular language. FIGURE]: ... multilingual SLDS and initially it is able to hold dialogues in Spanish, Catalan, as well as in Latin American Spanish. Moreover the user can change the...

Ngày tải lên: 24/03/2014, 03:20

... English as a Second Language Foreign Language Building 707 S. Mathews Urbana, IL 61801 U.S .A. ABSTRACT The speech synthesis group at the Computer- Based Education Research Laboratory (CERL) of ... University of Illlnols at Urbana-Champalgn Computer-based Education Research Laboratory 103 S. Hathews Urbana, IL 61801 U.S .A. Wayne B. Dickerson University of Illinoi...

Ngày tải lên: 24/03/2014, 05:21

... with cases where a particular word or phrase annotated by the recognizer (such as time ) can have both temporal or non-temporal interpretations. Then, for each candidate that really is a temporal ... is that it is important to keep in mind a clear distinction between, on the one hand, the conceptual model of temporal entities that a partic- ular approach adopts; and, on the...

Ngày tải lên: 31/03/2014, 01:20

... strain rate and strain at low dose dobutamine, a further increase in strain rate at high dose, when strain showed a plateau due to the increased heart rate. Their study confirms that SRI may have ... from an apical window, increase progressively from the apex towards the base. During the cardiac cycle the ventricular apex is relatively stationary, while the mitral ring moves t...

Ngày tải lên: 29/06/2014, 11:20