... perforation, and a poor general state of health. Case presentation A 54-year-old Caucasian Greek man presented to the Accident and Emergency department of our hospital with a 20-day history of ... ergency that still carries a risk of mortality. We successfully managed a rare and difficult case of simultaneous perforation of duo- denal and gastric ulcers...
Ngày tải lên: 11/08/2014, 03:21
Báo cáo y học: " Synchronous perforation of a duodenal and gastric ulcer: a case report" potx
... perforation is a surgical emergency with a high risk of mortality and morbidity. Case presentation: We present a rare case of a 54-year-old Caucasian man who underwent an emergency laparotomy ... their protocol. Discussion Perforation of a peptic ulcer is a su rgical em ergency that still carries a risk of mortality. We successfully managed a rare and diffi...
Ngày tải lên: 11/08/2014, 07:20
... primers (5'TTTTTATCGATAAGCTCAATATTGGCCATATTATTCAT TGG3' and 5'TTTTCATATGCAGTTGTTACGACATTTTGGAAAG3') and ligated with NdeI-ClaI-digested PCE-Luc and U3-Luc in order to create IE-PCE-Luc and IE-U3-Luc, respectively. Transient ... design of the study and carried out the statis- tical analysis. MDL participated in the preparation of the manuscript. KBL coordinate...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: "Natural selection of protein structural and functional properties: a single nucleotide polymorphism perspect" potx
... activity Oxidoreductase activity Transferase activity Hydrolase activity Lyase activity Isomerase activity Ligase activity Enzyme regulator activity Transcription regulator activity Translation regulator activity SNP ... manuscript. All authors read and approved the final manuscript. Additional data files The following additional data are available. Additional data file 1 includes Table S1...
Ngày tải lên: 14/08/2014, 08:21
Báo cáo y học: "Negative regulation of cytokine signaling and immune responses by SOCS proteins" potx
... Nagai H, Emi M, Terada Y, Yabe A, Jin E, Kawanami O, Konishi N, Moriyama Y, Naka T, et al.: Hypermethylation- associated inactivation of the SOCS-1 gene, a JAK/STAT inhibitor, in human pancreatic ... indicated that STAT3 activation was 1 day ahead of SOCS3 induction; STAT3 activation became apparent during days 3 to 5 and decreased thereafter, whereas SOCS3 expression was induced a...
Ngày tải lên: 09/08/2014, 06:23
Báo cáo y học: "The outcomes of severe sepsis and septic shock in the UK" potx
Ngày tải lên: 12/08/2014, 23:24
Báo cáo y học: " Co-infection by Streptococcus anginosus and Mycobacterium tuberculosis: three case reports" potx
... patient data and was a major contributor in writing the manuscript. CJ analyzed and interpreted the patient data and was a major contrib- utor in writing the manuscript. MR analyzed the data and was ... probably causing ero- sions in the mucosa of the duodenum that favoured the spread of the SAG to the liver and adrenal gland. Tuberculous psoas and paravertebral muscle abs...
Ngày tải lên: 11/08/2014, 19:21
báo cáo khoa học: "Synchronous perforation of non-Hodgkin’s lymphoma of the small intestine and colon: a case report" ppsx
... complaints and the rari ty of intestinal obstruc- tion probably account for the delays in diagnosis. Early diagnosis and systemic chemotherapy may prevent the occurrence of perforation and the ... complications. Poor prognostic factors include advanced age, late stage disease, and a poor performance status, as well as delay and contraindication of chemotherapy. The prognos...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"
... 2001;413(6853):316-22. 4. Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI. Phosphorylation-dependent degradation of c-Myc is mediated by the F-box ... Germany using the ABI PRISM Big Dye Terminator system (Applied Biosystems, Germany). Sequences were analyzed using the Chromas software (Technely- sium Pty Ltd, Tewantin...
Ngày tải lên: 31/10/2012, 16:49
Báo cáo Y học: Fluorescent analogs of UDP-glucose and their use in characterizing substrate binding by toxin A from Clostridium difficile pdf
... in particular. These substrate analogs are related to the commercially available methylanthraniloyl (mant) derivatives of ATP and GTP commonly used in mechanistic studies of ATPases and GTPases. ... were measured and averaged over five scans. Data were analyzed by nonlinear least squares curve-fitting to standard binding isotherms by using the program KALEIDAGRAPH (Synergy Software)....
Ngày tải lên: 08/03/2014, 22:20