Báo cáo y học: "Silent onset of postmenopausal endometriosis in a woman with renal failure in hormone replacement therapy: a case report" pdf

Báo cáo y học: "Silent onset of postmenopausal endometriosis in a woman with renal failure in hormone replacement therapy: a case report" doc

Báo cáo y học: "Silent onset of postmenopausal endometriosis in a woman with renal failure in hormone replacement therapy: a case report" doc

... Indraccolo and Barbieri : Silent onset of postmenopausal endometriosis in a woman with renal failure in hormone replacement therapy: a case report. Journal of Medical Case Reports 2010 4:248. Submit your ... clinicians must certainly keep in mind that postmenopausal endometriosis can appear in an atypical mann er and could go undetected, lea ding to...

Ngày tải lên: 11/08/2014, 03:21

3 322 0
Báo cáo y học: "Silent onset of postmenopausal endometriosis in a woman with renal failure in hormone replacement therapy: a case report" pdf

Báo cáo y học: "Silent onset of postmenopausal endometriosis in a woman with renal failure in hormone replacement therapy: a case report" pdf

... Indraccolo and Barbieri : Silent onset of postmenopausal endometriosis in a woman with renal failure in hormone replacement therapy: a case report. Journal of Medical Case Reports 2010 4:248. Submit your ... clinicians must certainly keep in mind that postmenopausal endometriosis can appear in an atypical mann er and could go undetected, lea ding to...

Ngày tải lên: 11/08/2014, 07:20

3 240 0
Báo cáo y học: "Postnatal onset of severe growth retardation after in utero exposure to carbamazepine and phenobarbital: a case report" ppsx

Báo cáo y học: "Postnatal onset of severe growth retardation after in utero exposure to carbamazepine and phenobarbital: a case report" ppsx

... mothers using carbamazepine, oxcarbazepine, or phenytoin (as monotherapy or poly- therapy without valproate). In rats, Manent et al. [4] reported that prenatal exposure to vigabatrin and valpro- ate, ... pelvis, hypospadias, and inguinal hernia. In a cohort of female patients with epilepsy, Artama et al. [3] reported that the risk for congenital malformations was not elevated in o...

Ngày tải lên: 11/08/2014, 17:21

3 299 0
Báo cáo Y học: Co-existence of two regulatory NADP-glyceraldehyde 3-P dehydrogenase complexes in higher plant chloroplasts ppt

Báo cáo Y học: Co-existence of two regulatory NADP-glyceraldehyde 3-P dehydrogenase complexes in higher plant chloroplasts ppt

... then addedtostromalextractsthathadbeenpreincubatedwith 140 l M NAD and 20 m M GSSG. After incubation for 30 min, the supernatant was used to assay for GAPDH and PRK activities after full activation. The antisera against CP12 and NADP-GAPDH ... residual GAPDH activity obtained in vitro is rather the result of the high 1,3-bisphosphoglycerate con- centration (21 l M ) in the standard assa...

Ngày tải lên: 08/03/2014, 09:20

8 426 0
Báo cáo Y học: Distinct parts of minichromosome maintenance protein 2 associate with histone H3/H4 and RNA polymerase II holoenzyme pptx

Báo cáo Y học: Distinct parts of minichromosome maintenance protein 2 associate with histone H3/H4 and RNA polymerase II holoenzyme pptx

... examined the binding of MCMs to the H3/H4 resin using an antibody against the conserved ATP binding domain of all MCM proteins [49]. This antibody cross- reacts with many bands in crude extracts; ... expressed in 293 cells and extracted at comparable levels (Fig. 7A) . Each extract was assayed by GST-TFIIS affinity chromatography. Load, flowthrough, wash and 0.325 M NaCl eluate fracti...

Ngày tải lên: 17/03/2014, 10:20

11 387 0
Báo cáo Y học: Supermolecular organization of photosystem II and its associated light-harvesting antenna in Arabidopsis thaliana docx

Báo cáo Y học: Supermolecular organization of photosystem II and its associated light-harvesting antenna in Arabidopsis thaliana docx

... for analysis by repeated alignments, multivariate statistical analysis and classification, in a very similar way as carried out previously with spinach inside-out paired membranes [17]. To extract ... Arabidopsis thaliana by EM and image analysis. Two approaches were followed: the periodic approach (analysis of crystalline membrane fragments) indicated a new type of crystal lattice...

Ngày tải lên: 24/03/2014, 04:21

9 363 0
Báo cáo y học: "The abilities of improved schizophrenia patients to work and live independently in the community: a 10-year long-term outcome study from Mumbai, India" ppsx

Báo cáo y học: "The abilities of improved schizophrenia patients to work and live independently in the community: a 10-year long-term outcome study from Mumbai, India" ppsx

... from Mumbai, India Amresh Kumar Srivastava* 1,5 , Larry Stitt 2 , Meghana Thakar 1 , Nilesh Shah 3 and Gurusamy Chinnasamy 4 Address: 1 Mental Health Foundation of India (PRERANA Charitable Trust) ... the sad reality in mental health. Parallel to physical health, changing expectations in mental health have been demanding. It has also been argued that acute transient psychosis, a di...

Ngày tải lên: 08/08/2014, 23:21

8 511 0
Báo cáo y học: "Enhanced expression of interferon-inducible protein 10 associated with Th1 profiles of chemokine receptor in autoimmune pulmonary" pptx

Báo cáo y học: "Enhanced expression of interferon-inducible protein 10 associated with Th1 profiles of chemokine receptor in autoimmune pulmonary" pptx

... profiles of chemokine receptor in autoimmune pulmonary inflammation of MRL/ lpr mice Fumitaka Shiozawa, Tsuyoshi Kasama, Nobuyuki Yajima, Tsuyoshi Odai, Takeo Isozaki, Mizuho Matsunawa, Yoshiyuki Yoda, ... Nakashima H, Tanaka Y, Kohsaka T, Nagano S, Ohgami E, Arinobu Y, Yamaoka K, Niiro H, Shinozaki M, Hirakata H, Horiuchi T, Otsuka T, Niho Y: Th1/Th2 balance of peripheral T helpe...

Ngày tải lên: 09/08/2014, 01:23

9 356 0
Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx

Báo cáo y học: "Regional assessment of articular cartilage gene expression and small proteoglycan metabolism in an animal model of osteoarthritis" pptx

... CAAACTCTTTTGCTTGGGCT R CACTGGACAACTCGCAGATG AF125041 Biglycan 65 204 F CCATGCTGAACGATGAGGAA R CATTATTCTGCAGGTCCAGC AF034842 Fibromodulin 65 442 F CTGGACCACAACAACCTGAC R GGATCTTCTGCAGCTGGTTG AF020291 Lumican ... CCTCCAGGTCAGCTTCGCAA NM174030 Collagen I 65 460 F CCACCAGTCACCTGCGTACA R GGAGACCACGAGGACCAGAA AF129287 Collagen III 55 243 F GCTGGCTAGTTGTCGCTCTG R GTGGGGAAACTGCACAACAT L47641 GAPDH 55...

Ngày tải lên: 09/08/2014, 06:23

10 416 0
Báo cáo y học: "Chronic development of collagen-induced arthritis is associated with arthritogenic antibodies against specific epitopes on type II collagen" ppt

Báo cáo y học: "Chronic development of collagen-induced arthritis is associated with arthritogenic antibodies against specific epitopes on type II collagen" ppt

... phenylalanine; A, alanine; L, leucine; T, threonine; Y, tyrosine; εACA, ε-aminohexanoic acid-lysine-lysine- tyrosine-glycine-OH. b Absorbance at 405 nm in ELISA tested with affinity-purified mAbs. ... for affinity chromatography were prepared in accordance with the GammaBind Sepharose manual. The mAbs were dialyzed against PBS. The concentrations of the mAbs were determined by fr...

Ngày tải lên: 09/08/2014, 07:20

10 317 0
Từ khóa:
w