Báo cáo y học: "Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

Báo cáo y học: " Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

Báo cáo y học: " Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

... 4 CAS E REP O R T Open Access Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report Elaine Lin 1 , ... as an incidental laboratory finding. Although leukemias represent only about eight percent of neoplastic metastases to the heart, almost 50% of lymphom...

Ngày tải lên: 11/08/2014, 03:21

4 398 0
Báo cáo y học: "Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

Báo cáo y học: "Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report" pptx

... 4 CAS E REP O R T Open Access Cardiac tamponade mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case report Elaine Lin 1 , ... mimicking tuberculous pericarditis as the initial presentation of chronic lymphocytic leukemia in a 58-year-old woman: a case...

Ngày tải lên: 11/08/2014, 07:20

4 399 0
Báo cáo y học: "Subacute herpes simplex virus type 1 encephalitis as an initial presentation of chronic lymphocytic leukemia and multiple sclerosis: a case report" doc

Báo cáo y học: "Subacute herpes simplex virus type 1 encephalitis as an initial presentation of chronic lymphocytic leukemia and multiple sclerosis: a case report" doc

... Correspondence: rashi.l.singhal@gmail.com The University of Alabama at Birmingham, Huntsville, Alabama, USA Singhal and Corman Journal of Medical Case Reports 2011, 5:59 http://www.jmedicalcasereports.com/content/5/1/59 JOURNAL ... this article as: Singhal and Corman: Subacute herpes simplex virus type 1 encephalitis as an initial presentation of chronic lymphocytic leuk...

Ngày tải lên: 11/08/2014, 00:22

7 403 0
Tài liệu Báo cáo Y học: Interallelic complementation provides genetic evidence for the multimeric organization of the Phycomyces blakesleeanus phytoene dehydrogenase doc

Tài liệu Báo cáo Y học: Interallelic complementation provides genetic evidence for the multimeric organization of the Phycomyces blakesleeanus phytoene dehydrogenase doc

... de Salamanca, Edi®cio Departamental, Avda, Salamanca, Spain; 2 Centro Hispano-Luso de Investigaciones Agrarias, Universidad de Salamanca, Edi®ci o Departamental, Avda, Salamanca, Spain The Phycomyces ... analysis Nucleotide and amino-acid sequences were analysed u sing the Vector NTI Suite software package (InforMax, Inc.). Access to the PROSITE database of protein families and domain...

Ngày tải lên: 22/02/2014, 04:20

7 479 0
Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt

Báo cáo Y học: Holliday junction binding and processing by the RuvA protein of Mycoplasma pneumoniae ppt

... (TGCCGAATTCTA CCAGTGCCAGTGAAGGACATCTTTGCCCACGTTG ACCC), 4 ( CAACGTCATAGACGATTACATTG CTAC ATGGAGCTGTCTAGAGGATCCGA). A three-strand junction was made by o mitting strand 4 and a 37-bp duplex DNA by annealing ... labelled with biotin ( bio) at the 5¢ end of one strand: 1 (bio-AAAAATGGGTCAACGTGGGCAA AGATGTCCTAGCAATGTAATCGTCTATGACGTT), 2 ( GTCGGATCCTCTAGACAGCTCCATGTTCACTG GCACTGGTAGAATTCGG...

Ngày tải lên: 17/03/2014, 17:20

9 542 0
Báo cáo Y học: S-Decyl-glutathione nonspecifically stimulates the ATPase activity of the nucleotide-binding domains of the human multidrug resistance-associated protein, MRP1 (ABCC1) ppt

Báo cáo Y học: S-Decyl-glutathione nonspecifically stimulates the ATPase activity of the nucleotide-binding domains of the human multidrug resistance-associated protein, MRP1 (ABCC1) ppt

... temperature. The ATPase activity was determined as described in Materials and methods and calculated relative to the activity measured in absence of surfactant. Error bars indicate standard deviations. ... bilayer. The hydrolysis of ATP by both NBDs of MRP1 was dependent on divalent cations and was inhibited by ATPase inhibitors, such as ortho-vanadate and azide. Our data...

Ngày tải lên: 17/03/2014, 23:20

9 564 0
Báo cáo y học: "Exogenous glucosamine globally protects chondrocytes from the arthritogenic effects of IL-1β" docx

Báo cáo y học: "Exogenous glucosamine globally protects chondrocytes from the arthritogenic effects of IL-1β" docx

... protein Forward, GCATCAAGTGGACCAAGCTA Reverse, GTAACTCCAATGCCACCACA Collagen alpha 1 type II Forward, GTGGAGCAGCAAGAGCAAGGA Reverse, CTTGCCCCACTTACCAGTGTG CXCL5 (LIX) Forward, CACCCTGCTGGCATTTCTG Reverse, ... central player in inflammatory signal transduction, IL-1 and TNF also share the capacity to activate the stress-activated protein kinase/c-Jun N-terminal kinase and p38 mitogen-act...

Ngày tải lên: 09/08/2014, 08:23

14 405 0
Báo cáo y học: "HLA-C locus alleles may modulate the clinical expression of psoriatic arthritis" potx

Báo cáo y học: "HLA-C locus alleles may modulate the clinical expression of psoriatic arthritis" potx

... was also analysed in the three groups of PsA. The strength of the association between HLA-C/B27 antigens and disease was calculated by odds ratio (OR), and the statis- tical significance of these ... genes. The latter may explain why some HLA genes originally associated with PsA susceptibility are now being considered part of the ancestral haplotypes related to psoriasis...

Ngày tải lên: 09/08/2014, 08:23

5 369 0
Báo cáo y học: "Three-dimensional and thermal surface imaging produces reliable measures of joint shape and temperature: a potential tool for quantifying arthritis" pdf

Báo cáo y học: "Three-dimensional and thermal surface imaging produces reliable measures of joint shape and temperature: a potential tool for quantifying arthritis" pdf

... com- plaints of increased swelling, stiffness, pain, and warmth in the right wrist. Her wrist was re-imaged. An increase in swelling, particularly on the dorsolateral aspect of the wrist, was visually apparent ... inflammatory state of the joint would improve the ability to quantify disease activity. Such a measure could be used to assess response to therapy in both t...

Ngày tải lên: 09/08/2014, 10:22

9 345 0
Báo cáo y học: "Mannose-binding lectin deficiency is associated with early onset of polyarticular juvenile rheumatoid arthritis: a cohort study" pdf

Báo cáo y học: "Mannose-binding lectin deficiency is associated with early onset of polyarticular juvenile rheumatoid arthritis: a cohort study" pdf

... The influence of the X /Y allele was also determined by studying six 'extended' genotype groups: YA/YA, YA/XA, XA/XA, YA/O, XA/O and O/O. Statistical analysis Data are presented as median and ... agents in the host may enhance synovial inflammation because of the proin- flammatory effects of bacterial DNA and bacterial cell wall fragments [35,36]. Anti-MBL autoant...

Ngày tải lên: 09/08/2014, 10:23

11 401 0
w