Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx
Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf
... protection against obesity and insulin
resistance induced by a diet high in trans fat in mice. Journal of
Inflammation 2011 8:2.
Submit your next manuscript to BioMed Central
and take full advantage of: ... signaling by trasducing pro-
duction of proinflammatory markers in macrophages,
adipocytes, and liver leading to insulin resistance. Insu-
lin...
Báo cáo y học: "Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in mice" docx
... protection against obesity and insulin
resistance induced by a diet high in trans fat in mice. Journal of
Inflammation 2011 8:2.
Submit your next manuscript to BioMed Central
and take full advantage of: ... signaling by trasducing pro-
duction of proinflammatory markers in macrophages,
adipocytes, and liver leading to insulin resistance. Insu-
lin...
Báo cáo Y học: Loss-of-function variants of the human melanocortin-1 receptor gene in melanoma cells define structural determinants of receptor function doc
... loss of binding affinity observed in
radioligand binding assays (Fig. 6B). This reduced affinity
for NDP-MSH of the Glu94Arg variant was evident by a
Fig. 6. Functional analysis of an artificial MC1R ... FEBS 2002
antibody. Comparable loading and transfer were ascer-
tained by cutting the lower portion of the membrane
before blocking and staining for total protein with Amido...
Báo cáo y học: "Loss of genes implicated in gastric function during platypus evolution" docx
... provided platypus and echidna sam-
ples. All authors read and approved the final manuscript.
Additional data files
The following additional data files are available. Additional
data file 1 is a figure ... bp)
GACTCTCTGAATGGGAAGTCATTTTGCATCACCT LINE2 SINE LINE2 TCCAGTGGATTATAGGGAATAACTTCACTGGGCAGTTTTATTCCATCTTTGATCATGGGAATAACTTTGTTGGAATTGC CCCAATTATTCCTTAG SINE
DSLNGKSFC
WIIGNNFTGQFYSIFD...
báo cáo khoa học: "Loss-of-function mutations affecting a specific Glycine max R2R3 MYB transcription factor result in brown hilum and brown seed coats" docx
... coat/hilum phenotype in soybean.
Background
Domestication of Soybean
Soybean [Glycine max (L.) Merr.] is a remarkable plant,
producing both high quality oil and protein and is one
of the primary ... anthocyanins to seed coats. Thoug h
hypothetical, this may represent a viable, alternate
means to visually select for transgene integration and/ or
a visual means to assist in...
Báo cáo y học: "Role of γδ T cells in protecting normal airway function" docx
... methacholine (MCh), namely
increased lung resistance (measured plethysmographi-
cally) and decreased dynamic compliance, a correlate of
the ability of the airways to recoil after the release of air
pressure ... (to
E.W.G.).
References
Articles of particular interest have been highlighted as:
•
of special interest
••
of outstanding interest
1. Saito H, Kranz DM, Takagaki Y,...
Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"
... glucose (FBG), insulin, triglyceride
(TG), cholesterol (CHOL), ALT, aspartate amino-
transferase (AST), γ-glutamyltransferase (GGT), alka-
line phosphatases (ALP), albumin (Alb) and globulin
(Glb) ... recruited into this study. The levels of fasting blood
glucose (FBG), fasting insulin (FINS), triglyceride (TG), cholesterol (CHOL), alanine amino-
transferase (ALT), aspartate aminotr...
Báo cáo y học: "Management of HBV Infection in Liver Transplantation Patients"
...
Transplantation at Cedars-Sinai Medical Center. His basic and translational research interests
involve the immunological and inflammatory mechanisms of pathogenesis in alloimmune and
autoimmune ... contributing to the efficacy of combination LAM and HBIG remain poorly defined.
Postulated mechanisms include the synergy of: 1) LAM reducing HBV replication and altering synth...
Báo cáo Y học: Inhibition of hyaluronan synthesis in Streptococcus equi FM100 by 4-methylumbelliferone doc
... containing fatty acids
with a particular chain length and unsaturation pattern, and
that the MU treatment of cells decreases the availability of
these favorable CL species. Additionally, the interaction ... Shinomura, T., Hamaguchi, M., Yoshida, Y. ,
Ohnuki, Y. , Miyauchi, S., Spicer, A. P., McDonald, J .A. &
Kimata, K. (1999) Three isoforms of mammalian hyaluronan
synthase...
Báo cáo Y học: Role of tyrosine 238 in the active site of Rhodotorula gracilis D-amino acid oxidase A site-directed mutagenesis study docx
... flavin position is also marginally
altered by the substitution of Y2 38 (Table 2).
Steady-state and rapid reaction kinetics with
D
-alanine
The ability of the Y2 38 mutants to catalyse
D
-alanine/
oxygen ... half-reaction of Y2 38 mutants with
D
-alanine
was measured by mixing anaerobically a solution of each
mutant enzyme with solutions containing varying concen-
trations...
Từ khóa: