Báo cáo y học: " Wound trauma mediated inflammatory signaling attenuates a tissue regenerative response in MRL/MpJ mice" ppsx

... this article as: Zins et al., Wound trauma mediated inflammatory signal- ing attenuates a tissue regenerative response in MRL/MpJ mice Journal of Inflammation 2010, 7:25 Zins et al. Journal of Inflammation ... ear-hole wound margins. In addition, we observed a significantly augmented inflammatory response in the serum, lung, ear wound, and burn wound marg...

Ngày tải lên: 11/08/2014, 03:20

... [4-8,12,13,16]. In this study, we demonstrate that systemic wound trauma inflammatory signaling, mediated by acute thermal injury, attenuates normal ear-hole closure and scarless Figure 2 Cutaneous dermal ... link between local injury and a systemic response. Similar to our findings Schwa- cha et al [29], reported a significant inflammatory response after burn wounds in...

Ngày tải lên: 11/08/2014, 06:22

... mechanisms. Conclusion In conclusion, reduced bioavailability of arginine in the airways may enhance inflammation by enhancing pro- inflammatory mediator production by epithelial cells. As pro -inflammatory peroxynitrites ... purposes) by poly-L-arginine is similar at 0 and 100 μM arginine in the medium, it is likely that poly-L-arginine also inhibited arginine uptake markedly at 1 m...

Ngày tải lên: 12/08/2014, 14:20

... study of inflammatory arthritis. Introduction Ankylosing spondylitis (AS) and related spondyloarthropathies (SpA) are strongly associated with the major histocompatibilty complex (MHC) class I allele ... properly cited. Abstract Introduction Ankylosing spondylitis (AS) is a severe, chronic inflammatory arthritis, with a strong association to the human major histocompatibilty complex (...

Ngày tải lên: 09/08/2014, 13:21

... Royal Infirmary of Edinburgh, Edinburgh, UK. 3 Department of Anaesthetics, Royal Infirmary of Edinburgh, Edinburgh, UK. Authors’ contributions KS participated as first assistant in the operation, ... Correspondence: kasrash@gmail.com 1 Department of Cardiothoracic Surgery, Royal Infirmary of Edinburgh, Edinburgh, UK Full list of author information is available at the end of the article Shai...

Ngày tải lên: 10/08/2014, 09:22

... physician and thus knows the available options, he asked for an intramedullary nail and the surgeon agreed. Post-surgi- cally, the pain disappeared initially, but it returned after a few days. An ... on an intramedullary nailing after he was advised to have the dis- placed fracture being fixed. A study of the Canadian Orthopedic Trau ma Society in 2007 [8] showed that an operative treat...

Ngày tải lên: 10/08/2014, 10:20

... tomography can facilitate a prompt diagnosis and appropriate management steps can then be taken accordingly. Introduction Spontaneous rupture of hepatic metastases leading to hemoperitoneum may initially ... convey key teaching points: (A) the need to consider intra-abdominal hemorrhage in the differential diagnosis when assessing patients with collapse; and (B) the use of appropriate i...

Ngày tải lên: 11/08/2014, 12:20

... 432 DenSi-2 AACUGUGCAUUGAAGCCAAAA 929 DenSi-3 AACAGGGCUAGACUUCAAUGA 1320 DenSi-4 AAGAAGAAUGGAGCGAUCAAA 133 control siRNA UUCUCCGAACGUGUCACGUdT – Four siRNA sequences (table 1) against different parts ... time point, and measured by flow cytometry. siRNA positive cell rate was calculated as the percentage of cells con- taining fluorescent signals. 9. Statistical analysis All values were presen...

Ngày tải lên: 12/08/2014, 01:22

... in asthmatic status. This study expands our concept of the regulatory role of intracranial inflammatory mediators in inflammatory diseases including asthma, and suggests a link between intracra- nial ... This study expands our concept of the regulatory role of intracranial inflammatory mediators in inflammatory diseases including asthma. The favourable effects of LTB 4 on the...

Ngày tải lên: 12/08/2014, 11:21

... LXs are biologically active in resolving inflammation (reviewed in reference [17]). Interestingly, when the data was expressed as a ratio of pro -inflammatory LTB 4 to anti -inflammatory LXA 4 , ... net pro -inflammatory imbalance in severe asthma. Abbreviations AM: alveolar macrophage; BAL: bronchoalveolar lavage; BALF: bronchoalveolar lavage fluid; CS: corticosteroid; Dex: dexam...

Ngày tải lên: 12/08/2014, 11:22