Báo cáo y học: " Wound trauma mediated inflammatory signaling attenuates a tissue regenerative response in MRL/MpJ mice" ppsx

Báo cáo y học: "Wound trauma mediated inflammatory signaling attenuates a tissue regenerative response in MRL/MpJ mice" pot

Báo cáo y học: "Wound trauma mediated inflammatory signaling attenuates a tissue regenerative response in MRL/MpJ mice" pot

... this article as: Zins et al., Wound trauma mediated inflammatory signal- ing attenuates a tissue regenerative response in MRL/MpJ mice Journal of Inflammation 2010, 7:25 Zins et al. Journal of Inflammation ... ear-hole wound margins. In addition, we observed a significantly augmented inflammatory response in the serum, lung, ear wound, and burn wound marg...

Ngày tải lên: 11/08/2014, 03:20

9 220 0
Báo cáo y học: " Wound trauma mediated inflammatory signaling attenuates a tissue regenerative response in MRL/MpJ mice" ppsx

Báo cáo y học: " Wound trauma mediated inflammatory signaling attenuates a tissue regenerative response in MRL/MpJ mice" ppsx

... [4-8,12,13,16]. In this study, we demonstrate that systemic wound trauma inflammatory signaling, mediated by acute thermal injury, attenuates normal ear-hole closure and scarless Figure 2 Cutaneous dermal ... link between local injury and a systemic response. Similar to our findings Schwa- cha et al [29], reported a significant inflammatory response after burn wounds in...

Ngày tải lên: 11/08/2014, 06:22

9 312 0
Báo cáo y học: " Arginine deficiency augments inflammatory mediator production by airway epithelial cells in vitro" pps

Báo cáo y học: " Arginine deficiency augments inflammatory mediator production by airway epithelial cells in vitro" pps

... mechanisms. Conclusion In conclusion, reduced bioavailability of arginine in the airways may enhance inflammation by enhancing pro- inflammatory mediator production by epithelial cells. As pro -inflammatory peroxynitrites ... purposes) by poly-L-arginine is similar at 0 and 100 μM arginine in the medium, it is likely that poly-L-arginine also inhibited arginine uptake markedly at 1 m...

Ngày tải lên: 12/08/2014, 14:20

12 172 0
Báo cáo y học: "Induction of HLA-B27 heavy chain homodimer formation after activation in dendritic cells" ppsx

Báo cáo y học: "Induction of HLA-B27 heavy chain homodimer formation after activation in dendritic cells" ppsx

... study of inflammatory arthritis. Introduction Ankylosing spondylitis (AS) and related spondyloarthropathies (SpA) are strongly associated with the major histocompatibilty complex (MHC) class I allele ... properly cited. Abstract Introduction Ankylosing spondylitis (AS) is a severe, chronic inflammatory arthritis, with a strong association to the human major histocompatibilty complex (...

Ngày tải lên: 09/08/2014, 13:21

7 335 0
Báo cáo y học: "Redo-redo aortic root replacement with a mechanical valved conduit in a patient with von Willebrand’s disease: Case repor" pps

Báo cáo y học: "Redo-redo aortic root replacement with a mechanical valved conduit in a patient with von Willebrand’s disease: Case repor" pps

... Royal Infirmary of Edinburgh, Edinburgh, UK. 3 Department of Anaesthetics, Royal Infirmary of Edinburgh, Edinburgh, UK. Authors’ contributions KS participated as first assistant in the operation, ... Correspondence: kasrash@gmail.com 1 Department of Cardiothoracic Surgery, Royal Infirmary of Edinburgh, Edinburgh, UK Full list of author information is available at the end of the article Shai...

Ngày tải lên: 10/08/2014, 09:22

3 270 0
Báo cáo y học: "Atrophy of the brachialis muscle after a displaced clavicle fracture in an Ironman triathlete: case report" docx

Báo cáo y học: "Atrophy of the brachialis muscle after a displaced clavicle fracture in an Ironman triathlete: case report" docx

... physician and thus knows the available options, he asked for an intramedullary nail and the surgeon agreed. Post-surgi- cally, the pain disappeared initially, but it returned after a few days. An ... on an intramedullary nailing after he was advised to have the dis- placed fracture being fixed. A study of the Canadian Orthopedic Trau ma Society in 2007 [8] showed that an operative treat...

Ngày tải lên: 10/08/2014, 10:20

4 319 0
Báo cáo y học: "Bleeding from ruptured hepatic metastases as a cause of syncope in an octogenarian: a case report" pdf

Báo cáo y học: "Bleeding from ruptured hepatic metastases as a cause of syncope in an octogenarian: a case report" pdf

... tomography can facilitate a prompt diagnosis and appropriate management steps can then be taken accordingly. Introduction Spontaneous rupture of hepatic metastases leading to hemoperitoneum may initially ... convey key teaching points: (A) the need to consider intra-abdominal hemorrhage in the differential diagnosis when assessing patients with collapse; and (B) the use of appropriate i...

Ngày tải lên: 11/08/2014, 12:20

3 372 0
Báo cáo y học: " Inhibitory effect of small interfering RNA on dengue virus replication in mosquito cells" ppsx

Báo cáo y học: " Inhibitory effect of small interfering RNA on dengue virus replication in mosquito cells" ppsx

... 432 DenSi-2 AACUGUGCAUUGAAGCCAAAA 929 DenSi-3 AACAGGGCUAGACUUCAAUGA 1320 DenSi-4 AAGAAGAAUGGAGCGAUCAAA 133 control siRNA UUCUCCGAACGUGUCACGUdT – Four siRNA sequences (table 1) against different parts ... time point, and measured by flow cytometry. siRNA positive cell rate was calculated as the percentage of cells con- taining fluorescent signals. 9. Statistical analysis All values were presen...

Ngày tải lên: 12/08/2014, 01:22

8 361 0
Báo cáo y học: " Intracerebroventricular injection of leukotriene B4 attenuates antigen-induced asthmatic response via BLT1 receptor stimulating HPA-axis in sensitized rats" ppt

Báo cáo y học: " Intracerebroventricular injection of leukotriene B4 attenuates antigen-induced asthmatic response via BLT1 receptor stimulating HPA-axis in sensitized rats" ppt

... in asthmatic status. This study expands our concept of the regulatory role of intracranial inflammatory mediators in inflammatory diseases including asthma, and suggests a link between intracra- nial ... This study expands our concept of the regulatory role of intracranial inflammatory mediators in inflammatory diseases including asthma. The favourable effects of LTB 4 on the...

Ngày tải lên: 12/08/2014, 11:21

9 185 0
Báo cáo y học: "Corticosteroid suppression of lipoxin A4 and leukotriene B4from alveolar macrophages in severe asthma" ppsx

Báo cáo y học: "Corticosteroid suppression of lipoxin A4 and leukotriene B4from alveolar macrophages in severe asthma" ppsx

... LXs are biologically active in resolving inflammation (reviewed in reference [17]). Interestingly, when the data was expressed as a ratio of pro -inflammatory LTB 4 to anti -inflammatory LXA 4 , ... net pro -inflammatory imbalance in severe asthma. Abbreviations AM: alveolar macrophage; BAL: bronchoalveolar lavage; BALF: bronchoalveolar lavage fluid; CS: corticosteroid; Dex: dexam...

Ngày tải lên: 12/08/2014, 11:22

9 255 0
Từ khóa:
w