báo cáo khoa học: " A group randomized trial of a complexity-based organizational intervention to improve risk factors for diabetes complications in primary care settings: study protocol" ppsx
... when a trained facilitator meets with staff and clinicians in each practice over several months to assist the team in addressing an issue, such as improving risk factors for diabetes complications. ... are to: 1. Evaluate the effectiveness and sustainability of PF to improve risk factors for type 2 diabetes complications across a variety of primary ca...
Ngày tải lên: 11/08/2014, 05:22
... use of telecommunications as a health intervention exist in some parts of Africa and in much of Asia. At present, one would hope that healthcare applications such as accessing medical self care, ... than anecdotal, certain functional and structural properties of mobile phones may make them attractive to use as a healthcare interven- tion. 1. Attractions of using mobile...
Ngày tải lên: 11/08/2014, 18:20
... similar to our study that included a tailored letter and telephone call to patients in a large HMO increased screening rates by 20%. This intervention had a relatively high estimated cost of additional ... for You', in VHS and DVD format. • A survey to be completed after watching the decision aid, measuring secondary outcomes of including interest and acceptab...
Ngày tải lên: 11/08/2014, 16:21
Tài liệu Báo cáo khoa học: The tandemly repeated domains of a b-propeller phytase act synergistically to increase catalytic efficiency doc
... degrades InsP 6 gradually into InsP 5 , InsP 4 , and the final product – Ins(2,4,6)P 3 and Ins(1,3,5)P 3 – via two alternative pathways [14]. Bacterial BPPs containing two tandemly repeated domains ... functional relationship of tandemly repeated domains in BPPs. We conjecture that dual-domain BPPs have succeeded evolutionarily because they can increase the amount of available phosphate...
Ngày tải lên: 14/02/2014, 15:20
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx
... putative allantoate amido- hydrolase, which is part of the urate catabolic pathway in many organisms [8]. In fact, by genome data mining, another hydantoinase (HYD) was also found in the Jannaschia ... used in the industrial production of optically pure amino acids. According to the EC nomenclature, d-hydantoinase is an alternative name for dihydropyrimidinase (EC 3.5.2.2) [3]...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx
... hAd2 in addition to an N-terminal Nco1 cloning site. The forward o ligomer 5 ¢-TCCGAAACCAGCG GCCGCTT TATCGCGTTA AAAC CGGT GATCAA ACCCC -3¢ and the reverse oligomer 5¢-GTAGGCCTT TGAATTCCTCAAAA AGTGCGGCTCGAT-3¢ ... 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys...
Ngày tải lên: 19/02/2014, 06:20
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
... last 10 sampling iterations. We also set a threshold to elesk similarity values, which yields better performance. Same as (Sinha and Mihalcea, 2007), values of elesk larger than 240 are set to ... 2000 iterations. For 3 It should be noted that this renders LDA a very challenging baseline to outperform. 142 Proceedings of the 50th Annual Meeting of the Association for Compu...
Ngày tải lên: 19/02/2014, 19:20
Tài liệu Báo cáo khoa học: Purification and characterization of a sialic acid specific lectin from the hemolymph of the freshwater crab Paratelphusa jacquemontii pdf
... preparation Blood for HA assay was prepared as described by Ravindranath et al. [12]. Hemagglutination assay Hemagglutination assays were performed in microtiter plates (Falcon) as recommended for ... for analyzing cell surface carbohydrates by cell agglutination, and for studying immunofluorescence and staining of tissue sections [51,67]. Clinical trials to inhibit cancer metast...
Ngày tải lên: 21/02/2014, 00:20
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf
... sufficient for metal-cluster binding. Only in the A F502 protein does an aspartate residue replace one of the five cysteine residues. Aspartate can in principle also function as a ligand of an iron-sulfur ... encoding proteins highly related to the AF499–AF503 proteins (Table 2) [23]. Polar insertion mutations immediately downstream of dsrA,andindsrB, dsrH,anddsrM, lead to a...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Identification and characterization of a nuclear receptor subfamily I member in the Platyhelminth Schistosoma mansoni (SmNR1) pot
... of A DNA binding domain B Ligand binding domain Fig. 1. Sequence alignment. (A) Alignment of DNA binding domain (C domain) and its C-terminal extension. (B) Alignment of ligand binding domain ... (GenBank AF129816) were previously ligated into activation domain vector pACT2 to form pACT-SmRXR1 and pACT- SmRXR2, and ligated into DNA binding domain vector pAS2 to form pAS-SmRXR1(C...
Ngày tải lên: 07/03/2014, 11:20