báo cáo khoa học: " Acceptance and perceived barriers of implementing a guideline for managing low back in general practice" doc

báo cáo khoa học: " Acceptance and perceived barriers of implementing a guideline for managing low back in general practice" doc

báo cáo khoa học: " Acceptance and perceived barriers of implementing a guideline for managing low back in general practice" doc

... with low back pain after history taking and physical exam in uncomplicated, radicular and complicated back pain instead of making an anatomical diagnosis is reasonable 92 5 3 ∅ The majority of ... in clinical studies: Effects of a media campaign on back pain beliefs and its potential influence on management of low back pain in general practice. Spine 2001...
Ngày tải lên : 11/08/2014, 05:22
  • 6
  • 350
  • 0
báo cáo khoa học: " Acceptance and perceived barriers of implementing a guideline for managing low back in general practice" pdf

báo cáo khoa học: " Acceptance and perceived barriers of implementing a guideline for managing low back in general practice" pdf

... with low back pain after history taking and physical exam in uncomplicated, radicular and complicated back pain instead of making an anatomical diagnosis is reasonable 92 5 3 ∅ The majority of ... article Acceptance and perceived barriers of implementing a guideline for managing low back in general practice Jean-François Chenot* 1 , Martin Scherer...
Ngày tải lên : 11/08/2014, 16:21
  • 6
  • 401
  • 0
Báo cáo khoa học: "Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand" potx

Báo cáo khoa học: "Detection and molecular characterization of infectious bronchitis virus isolated from recent outbreaks in broiler flocks in Thailand" potx

... isolates in group I had a distant relation to vaccine strains used in Thailand including Ma5, H120, M41, and Connecticut. New serotypes or variant strains can emerge as a result of only a few changes ... in Thailand. Although many different strains of live attenuated and inactivated vaccines have been widely used to control IB, the outbreaks of the disease have con...
Ngày tải lên : 07/08/2014, 23:22
  • 5
  • 537
  • 0
báo cáo khoa học: " Molecular and functional analyses of COPT/Ctrtype copper transporter-like gene family in rice" pdf

báo cáo khoa học: " Molecular and functional analyses of COPT/Ctrtype copper transporter-like gene family in rice" pdf

... yeast copper-uptake mutant and plasmids and Dr. David Eide of University of Wisconsin-Madison and Dr. Hongsheng Zhang of Nanjing Agricultural University for providing yeast iron-uptake mutant and ... interactions of COPTs. AIg5, a transmembrane protein with C terminal in the cytoplasm; NubI, N-terminal half of ubiquitin protein; NubG, mutated N-terminal half of ubiqu...
Ngày tải lên : 11/08/2014, 11:22
  • 12
  • 334
  • 0
Báo cáo hóa học: " Research Article Hardware Architecture of Reinforcement Learning Scheme for Dynamic Power Management in Embedded Systems" docx

Báo cáo hóa học: " Research Article Hardware Architecture of Reinforcement Learning Scheme for Dynamic Power Management in Embedded Systems" docx

... that can balance the workload against power. This paper focuses on implementing an intelligent Power Manager that can change policy according to workload. 3.2. Reinforcement learning A general ... policy) based on observations of the workload. It can be modeled as a power state machine, each state being characterized by the level of power consumption and performance. In additi...
Ngày tải lên : 22/06/2014, 19:20
  • 6
  • 268
  • 0
báo cáo khoa học: " Investigating the complementary value of discrete choice experiments for the evaluation of barriers and facilitators in implementation research: a questionnaire survey" pot

báo cáo khoa học: " Investigating the complementary value of discrete choice experiments for the evaluation of barriers and facilitators in implementation research: a questionnaire survey" pot

... the conception and design of the study, the analysis and inter- pretation of data, and has been involved in drafting and critically revising the manuscript for important intellec- tual content. MK has made ... design of the study and planning of the work that led to the manuscript, the acquisition, and interpretation of data, and has been involved in drafting an...
Ngày tải lên : 11/08/2014, 16:21
  • 12
  • 483
  • 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank ... 689–695. 42 Vitagliano L, Adinolfi S, Riccio A, Sica F, Zagari A & Mazzarella L (1998) Binding of a substrate analog to a domain swapping protein: X-ray structure...
Ngày tải lên : 14/02/2014, 22:20
  • 9
  • 626
  • 0
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGT K31 1A CGCGCTGAAAATTGGTAC CCAGTTTTAGTATCCACC G319D ... AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACT T56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG CAGCAAGCACATAATCCATGTCAAACCCAAAACACT Regulation of cytosolic 5¢...
Ngày tải lên : 15/02/2014, 01:20
  • 10
  • 563
  • 0
Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

Tài liệu Báo cáo khoa học: Structural and functional studies of the human phosphoribosyltransferase domain containing protein 1 docx

... methylation of GPR150, ITGA8 and HOXD11 in ovarian cancers. Life Sci 80, 1458–1465. 9 Suzuki E, Imoto I, Pimkhaokham A, Nakagawa T, Kamata N, Kozaki KI, Amagasa T & Inazawa J (2007) PRTFDC1, a ... for nucleotide formation with guanine and hypoxanthine bases, respectively, indicating that Asp137 functions as a catalytic base [12]. However, a tight binding of N7 of the...
Ngày tải lên : 15/02/2014, 01:20
  • 11
  • 770
  • 0