báo cáo khoa học: " A cluster randomised controlled trial of educational prompts in diabetes care: study protocol" pptx

... the effectiveness of the messages: general practice-held data; centrally-held and publicly available QOF data; and cen- trally-held laboratory data. We shall only use the QOF and laboratory data if we are unable ... is known about the effectiveness of the methods in increas- ing appropriate behaviour; the one study examining this was a trial of adding guidelines to patients&apos...

Ngày tải lên: 11/08/2014, 05:22

... charts comprise algorithms of decision-mak- ing aspects linked to the trial arm allocation. Depending on the allocated trial arm, participants are subjected to a set of planned interventions as ... approach in assigning individualised recall intervals for regular attendees instead of systematic deci- sion-making of fixed intervals. In The Netherlands, about 80% of the popu...

Ngày tải lên: 11/08/2014, 05:22

... criteria Health care utilization using administrative databases Alberta Health and Wellness, a branch of the Alberta pro- vincial government, is the custodian of several data sources that are accessible ... Alberta Ambulatory Care Classification System, the Alberta Health Care Insurance Plan (AHCIP) Payment Database, and the AHCIP Registry Dataset. All children 0–6 years of age and 6–...

Ngày tải lên: 11/08/2014, 05:22

... required data format. This format is based on rational criteria for laboratory test registration to facilitate the integration of the individual databases into one main database. All datasets on diagnostics ... Harteloh PPM: Kwaliteit van zorg: van zorginhoudelijke bena- dering naar bedrijfskundige aanpak [Quality of care: from a care standpoint towards a business management stand-...

Ngày tải lên: 11/08/2014, 16:21

... [16-18], laryngeal squamous cell car- cinoma [19], glioblastoma s [20], gastric adenocarcinoma [21] colorectal cancer [22] and gastrointestinal stromal carcinoma [23]. Gallbladder carcinoma (GBC) ... Sato N, Hiraga A, Watanabe I, Heike Y, Togashi K, Konishi J, et al: Rapid accumulation and internalization of radiolabeled herceptin in an inflammatory breast cancer xenograft with vasculog...

Ngày tải lên: 10/08/2014, 10:21

... for abstinence, based on data from the AHRQ Smoking Cessation Guideline Evaluation Trial [77]. Statistical analysis The primary clinical endpoint of this analysis is seven-day PPA at three and ... Steven.Fu@med.va.gov; Allan Prochazka - Allan.Prochazka@va.gov; Kathleen Grant - Kathleen.Grant2@va.gov; Lynne Buchanan - lbuchanan@unmc.edu; David Tinkelman - TinkelmanD@NJC.ORG; Heather Scha...

Ngày tải lên: 11/08/2014, 16:20

... ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA D genome ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA A B A ... ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA A B A genome CCTCGATTTTATTTTCTAATG...

Ngày tải lên: 12/08/2014, 03:21

... galactosyl bonds, such as those that decorate arabinogalactan proteins [21]. Finally, the appearance of the β-galactosidase spots in a train along the axis of the first dimension separation of ... histological and bio- chemical analyses, and particularly the importance of galactans and the secretory pathway in this process [6]. The apparent abundance of amylase suggests that s...

Ngày tải lên: 12/08/2014, 05:20

... and length of stay For missing data, patient clinical data will be obtained from the TASC database. Patients themselves will already have agreed to allow access to these data as part of the study ... that our intervention is both organisational, inter-professional (involving all team professionals), and patient-based (offering and refining clinical treatment protocols). Clinical nursing...

Ngày tải lên: 11/08/2014, 16:20

... tertiary care hospital. Clin Infect Dis 2009, 48:1182-1188. 16. Dalen DM, Zvonar RK, Jessamine PG: An evaluation of the management of asymptomatic catheter-associated bacteriuria and candiduria at ... JC, Saint S, Schaeffer AJ, Tambayh PA, Tenke P, Nicolle LE: Diagnosis, prevention, and treatment of catheter-associated urinary tract infection in adults: 2009 International Clinical Pra...

Ngày tải lên: 10/08/2014, 10:23