báo cáo khoa học: " A randomized controlled trial to prevent glycemic relapse in longitudinal diabetes care: Study protocol (NCT00362193)" pdf

... randomized controlled trial to prevent glycemic relapse in longitudinal diabetes care: Study protocol (NCT00362193) Mary Margaret Huizinga 2,3,12 , Ayumi Shintani 4 , Stephanie Michon 2 , Anne Brown 1,5 , ... Nashville, TN, USA and 12 VA National Quality Scholars Program, Nashville, TN, USA Email: Mary Margaret Huizinga - mary.margaret.huizinga@vanderbilt.edu; Ayu...

Ngày tải lên: 11/08/2014, 05:22

... relative to baseline, according to ACR criteria; DMARD = disease-modifying antirheumatic drug; IFN = interferon; IL = interleukin; ITT = intention to treat; RA = rheumatoid arthritis. Available ... factor and IL-1, and to down-regulate T-cell activity [2–5]. Since these proin- flammatory cytokines and activated T cells are thought to mediate inflammation and destruction of joint tis...

Ngày tải lên: 09/08/2014, 01:23

... Sociaux de Québec, Montréal, Québec, Canada Email: France Légaré* - france.legare@mfa.ulaval.ca; Antoine Boivin - antoine.boivin@gmail.com; Trudy van der Weijden - Trudy.vanderWeijden@HAG.unimaas.nl; ... organizations in Canada have started to call for a CPGs development process that will engage patients and the public in a more meaningful and effective way. The Canadian Medical As...

Ngày tải lên: 11/08/2014, 16:20

... health departments in Canada were invited to participate. Health departments in Canada were identified through provincial databases. Par- ticipants were recruited into the study in a two-stage ... Evanisko MJ: Organizational innovation: The influ- ence of individual, organizational, and contextual factors on hospital adoption of technological and administrative inno- vations. Acad...

Ngày tải lên: 11/08/2014, 05:21

... possible facets. Another key characteristic of rich domains like financial analysis, is that facts and events are subject to interpretation in context. To a finan- cial analyst, it makes a difference ... were annotated with the types of financial transactions they are most related to. Paragraphs that did not fall into a category of interest were classified as “other”. The annotat...

Ngày tải lên: 08/03/2014, 21:20

... and smaller spaces for more privacy. While there are no tradi- tional nursing stations, there is space for staff to engage in care planning and organization while maintaining visual contact with ... physical therapists, pharmacists, and social workers, as well as senior manag- ers and administrators) in four nursing homes in Edmon- ton, Alberta. The purposes of this study are to a...

Ngày tải lên: 10/08/2014, 10:23

... theory and adherence to treatment in diabetes. Am J Psychiatry 2001, 158:29-35. 44. Australian Institute of Health and Welfare (AIHW): The burden of dis- ease and injury in Australia Canberra: AIHW; ... Disease Studies[44] Regular surveys National Health Survey, ABS Cause of Death statistics etc. Administrative data sets Hospital data bases Inpatient minimum datasets, Outpatient minimu...

Ngày tải lên: 11/08/2014, 16:21

... ATTTACCCGCAGGTAAATTTAAAGCTTCAGTATTATGAAGCGCCTCCACTAGTCTACTTGCATATCTTACAAGAAAATTTATAATTCCTGTTTTCGCCTCTCTTTTTTCCA B genome ATTTACCCGCAGGTAAATTTAAAGCTTTACTATGA AACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA D genome ATTTACCCGCAGGTAAATTTAAAGCTTTATTATTATGAAACGCCTCCACTAGTCTAATTGCATATCTTATAAGAAAATTTATAATTCCTGTTTTCCCCTCTCTTTTTTCCA A B A ... ATTTACCCGCAGGTAAATTTAAAGCTTTA...

Ngày tải lên: 12/08/2014, 03:21