0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

báo cáo khoa học: " Role of "external facilitation" in implementation of research findings: a qualitative evaluation of facilitation experiences in the Veterans Health Administration" potx

báo cáo khoa học:

báo cáo khoa học: " Role of "external facilitation" in implementation of research findings: a qualitative evaluation of facilitation experiences in the Veterans Health Administration" potx

... AccessMethodology Role of "external facilitation& quot; in implementation of research findings: a qualitative evaluation of facilitation experiences in the Veterans Health AdministrationCheryl ... variousapproaches and processes, including facilitation, to enable implementation of best practices in the Veterans Health Administration health care system – the largest integrated healthcare system ... scheduling of team meetingsand record maintenance.Key components of external facilitation As noted above, facilitators appear to help internal changeagents actualize an implementation plan and, thereby,EBP...
  • 15
  • 362
  • 0
Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

Tài liệu Báo cáo khoa học: N-Methyl-L-amino acid dehydrogenase from Pseudomonas putida A novel member of an unusual NAD(P)-dependent oxidoreductase superfamily ppt

... isopropylamine, n-butylamine, n-amylamine, n-hexylamine, 1,6-diamino-hexane, and spermidine. Interestingly, the enzyme wasunable to use ammonia as a substrate and was distinctfrom alanine dehydrogenase ... Toyobo (Osaka, Japan), and New EnglandBiolabs (Beverly, MA, USA). All other reagents were of analytical grade from Nacalai Tesque (Kyoto, Japan) andWako Pure Chemical Industries (Osaka, Japan).Culture ... NADPH in a finalvolume of 50 lLat37°C. The N-methylphenylalanineformed was analyzed by HPLC as described above. OtherNMAADH assays were carried out by measuring the decrease in the amount of...
  • 7
  • 518
  • 0
Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf

Báo cáo khoa học: Post-ischemic brain damage: NF-jB dimer heterogeneity as a molecular determinant of neuron vulnerability pdf

... ‘classic’ pathway and the ‘alternative’ pathway, which result in the release of NF-jB from its inhibitors and in the nuclear localiza-tion of NF-jB [7]. The canonical pathway of NF-jBactivation ... Stimulation of both the calmodulin kinase II and Akt kinase pathways areresponsible for the upregulation of the p65 subunit of NF-jB [22]. Activation of PI3K, mitogen-activatedprotein kinase kinase ... generation of reactive oxygenspecies, DNA damage and in ammation. In focalischemia, primary neuronal death appears rapidly in the core area and is followed by secondary death in the ischemic penumbra...
  • 9
  • 527
  • 0
Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc

Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc

... uridylate AU-rich element-binding proteins in these tumor cells and in normal cell lines, respectivelyincreasing or decreasing the stability of uPA mRNAand therefore impairing or favoring their ... reproducibility. The expression of uPA and c-met mRNAs in the celllines shown in Fig. 2 was evaluated using a TaqMan GeneExpression Assay (Applied Biosystems). GAPDH was usedas an internal standard. The ... FEBS44 Tavian D, Salvi A, De Petro G & Barlati S (2003) Sta-ble expression of antisense urokinase mRNA inhibits the proliferation and invasion of human hepatocellularcarcinoma cells. Cancer...
  • 17
  • 287
  • 0
báo cáo khoa học:

báo cáo khoa học: "Harmonic scalpel versus flexible CO2 laser for tongue resection: A histopathological analysis of thermal damage in human cadavers" potx

... 13.0 was maintained for the data entry and statistical analysis. Thermal depthbetween harmonic scalpel and CO2 laser was comparedusing Independent sample T-test. A p-value less than0.05 was considered ... effective and p recise cutting tool in the head and neck region [3-6]. Each modality has theiradvantages and disadvantages. T he applicability of the laser particularly has been limited by line of ... 9:83http://www.wjso.com/content/9/1/83Page 5 of 6had a mean depth of thermal tissue damage of 0.69 mm,(0.51 - 0.82; SD 0.16). In comparison, the CO2 laser,applied in the same fashion had a mean depth of tissuedamage of 0.30...
  • 6
  • 390
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "Prolonged refractory status epilepticus following acute traumatic brain injury: a case report of excellent neurological recovery" docx

... of Calgary, Calgary, Alberta, Canada2 Research Fellow, Departments of Critical Care Medicine and Community Health Sciences, University of Calgary, Calgary, Alberta, Canada3Assistant Professor, ... Calgary, Alberta, Canada5Assistant Professor, Departments of Critical Care Medicine, Clinical Neurosciences and Community Health Sciences, University of Calgary, Calgary, Alberta, CanadaCorresponding ... Department of Neurosciences, University of Calgary, Alberta, Calgary, Canada4Associate Professor, Departments of Critical Care Medicine and Community Health Sciences, University of Calgary, Calgary,...
  • 4
  • 183
  • 0
báo cáo khoa học:

báo cáo khoa học: "Massive right-sided Bochdalek hernia with two unusual findings: a case report" docx

... reduction of large hernias is the loss of abdominal domain and the potential development of intra-abdominal hypertension.Due t o the long-standing di splacement of variousabdominal organs outside the ... the abdominal compartme nt,there is a decrease in the abdomen’ s capacity to accom-modate the herniated organs when they are reintro-duced. Abdominal hypertension can lead to ACScharacterized ... multiorgan dysfunction [3]. To mini-mize the risk of development of ACS, prosthetic meshclosure of the abdominal fascia was undertaken toincrease the abdominal compliance. A similar strategyhas...
  • 4
  • 414
  • 0
Tài liệu Báo cáo khoa học: Role of Kupffer cells in pathogenesis of sepsis-induced drug metabolizing dysfunction pptx

Tài liệu Báo cáo khoa học: Role of Kupffer cells in pathogenesis of sepsis-induced drug metabolizing dysfunction pptx

... (bp)CD163(XM_053094.2)Sense:AGCTGGGCTGTGCAGACAACGAntisense:TGAATGACCCCCGAGGATTTCAGC736CYP 1A1 (X00469)Sense:CTGGTTCTGGATACCCAGCTGAntisense:CCTAGGGTTGGTTACCAGG331CYP 1A2 (X01031)Sense:CAGTCACAACAGCCATCTTCAntisense:CCACTGCTTCTCATCATGGT302CYP2B1(XM_342078)Sense:TTGTTTGGTGCTGGGACAGAGAntisense:GGCTAGGCCCTCTCCTGCACA443CYP2E1(M20131)Sense:AAACTTCATGAAGAAATTGACAntisense:TCTCCAACACACACACGCTTTCC311TNF -a (X66539)Sense:GTAGCCCACGTCGTAGCAAAAntisense:CCCTTCTCCAGCTGGAAGAC346IL-6(NM_012589)Sense:GAAAGTCAACTCCATCTGCCAntisense:CATAGCACACTAGGTTTGCC678b-actin(BC063166)Sense:TTGTAACCAACTGGGACGATATGGAntisense:GATCTTGATCTTCATGGTGCTAG764T ... implicated in the activation of KCs[25]. The expression and activity of CYP2E1 weredownregulated in a rat hepatoma cell line after the administration of proinflammatory cytokines, leadingto a loss of ... (bp)CD163(XM_053094.2)Sense:AGCTGGGCTGTGCAGACAACGAntisense:TGAATGACCCCCGAGGATTTCAGC736CYP 1A1 (X00469)Sense:CTGGTTCTGGATACCCAGCTGAntisense:CCTAGGGTTGGTTACCAGG331CYP 1A2 (X01031)Sense:CAGTCACAACAGCCATCTTCAntisense:CCACTGCTTCTCATCATGGT302CYP2B1(XM_342078)Sense:TTGTTTGGTGCTGGGACAGAGAntisense:GGCTAGGCCCTCTCCTGCACA443CYP2E1(M20131)Sense:AAACTTCATGAAGAAATTGACAntisense:TCTCCAACACACACACGCTTTCC311TNF -a (X66539)Sense:GTAGCCCACGTCGTAGCAAAAntisense:CCCTTCTCCAGCTGGAAGAC346IL-6(NM_012589)Sense:GAAAGTCAACTCCATCTGCCAntisense:CATAGCACACTAGGTTTGCC678b-actin(BC063166)Sense:TTGTAACCAACTGGGACGATATGGAntisense:GATCTTGATCTTCATGGTGCTAG764T H. Kim et al. KCs in drug-metabolizing...
  • 11
  • 769
  • 0
Tài liệu Báo cáo khoa học: Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis pptx

Tài liệu Báo cáo khoa học: Role of the cag-pathogenicity island encoded type IV secretion system in Helicobacter pylori pathogenesis pptx

... restricted areas before a limited number of bacteria gain access to integrins and inject CagA. The basal injection model of CagA can also explain whyH. pylori does not cause more gastric damage in infected ... domain in the amino-termi-nal region of CagA [28]. In particular, CagA induces the ubiquitination and degradation of RUNX3,thereby extinguishing its ability to inhibit the transcrip-tional activation ... data suggest the presence of distinctEPIYA-independent domains within CagA that playessential roles in protein targeting and alteration of host-cell transcription signalling pathways.Another...
  • 13
  • 866
  • 0
Tài liệu Báo cáo khoa học: Role of ceramide kinase in peroxisome proliferatoractivated receptor beta-induced cell survival of mouse keratinocytes ppt

Tài liệu Báo cáo khoa học: Role of ceramide kinase in peroxisome proliferatoractivated receptor beta-induced cell survival of mouse keratinocytes ppt

... 5¢-GTAGGCATGAGAACGGGAAG-3 and for reverse 5¢-GGGGGTAAGAGGAGGAGAAA-3¢ and for CERK-negative forward 5¢-CCGCAAGAGGCTTTATTGTC-3 and reverse 5¢-TATGCCAAGGACACGGAGAT-3¢, as a negative control PCR primer. The condition ... MEBCYTO Apoptosis Kit waspurchased from Medical and Biological Laboratories(Nagoya, Japan), and a Nuclear Extract Kit was fromActive Motif (Carlsbad, CA, USA). The ChIP Assay Kitwas also a product ... immunoprecipitated chromatin, the CERK genesequence containing putative CERK-PPRE wasanalyzed by PCR. In the ChIP DNA obtained with the anti-PPARb IgG, the amount of DNA containingputative CERK-PPRE was...
  • 12
  • 698
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ