Báo cáo y học: "Development of a synoptic MRI report for primary rectal cancer" ppsx

... Lucia, Australia A novel photoactivatable analog of antisauvagine-30 (aSvg- 30), a specific antagonist for corticotropin-releasing factor (CRF) receptor, type 2 (CRF 2 ), has been synthesized and characterized. ... indicated on the right and left. Ó FEBS 20 02 Photoactivatable CRF 2 receptor antagonist (Eur. J. Biochem. 26 9) 529 3 Development of a sele...

Ngày tải lên: 31/03/2014, 08:20

... (principal component analysis and isomap method) Brain plan evaluation for (a) ANFIS and (b) human planFigure 7 Brain plan evaluation for (a) ANFIS and (b) human plan. The DVHs are shown in (c). ANFIS ... TPS at the level of deliverable plans Prostate plan evaluation for (a) ANFIS and (b) human planFigure 6 Prostate plan evaluation for (a) ANFIS and (b) human plan. The DVHs are show...

Ngày tải lên: 09/08/2014, 10:20

... previously shown to have good construct validity and moderate convergent validity with the DAS28 [16,17]. Because health care utilisation databases are a valuable source of data for studying health ... health care utilisation data indicators of RA severity We extracted the following information from the VA data- bases: rehabilitation visits (physical and occupational th...

Ngày tải lên: 09/08/2014, 10:23

... housed individually in standard breeding cages. Methods Electronic system for the recording of locomotor activity The locomotor activity of the animal is recorded automat- ically by means of microwave radar based ... very long monitoring of the animals, creating continuous time series. The data files are automatically saved to the hard disk, allowing im...

Ngày tải lên: 10/08/2014, 09:20

... (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles ... K, Kameda T, Takenaka K, Oku S, Abe H, Katayose KS, Kubuki Y, Kusumoto K, Hasuike S, Tahara Y, Nagata K, Matsuda T, Ohshima K, Harada M, Shimoda K: Development of ET, primary myelofibrosis a...

Ngày tải lên: 10/08/2014, 21:23

... Party: Clinical Practice Guidelines for the management of melanoma in Australia and New Zealand Wellington: Cancer Council Australia and Australian Cancer Network, Sydney and New Zealand Guidelines ... spectrum of malignant melanoma of the nail apparatus. Semin Dermatol 1991, 10:82-87. 22. Franke W, Neumann NJ, Ruzicka T, Schulte K: Plantar malignant melanoma -...

Ngày tải lên: 10/08/2014, 21:24

... identification, differentiation, and codification of the qualities and prop- erties of cases and classes of phenomena. 2. Systematic explanation: A theory must provide an explanation of the form and ... organization. We developed an applied theoretical model through analysis of empirical generalizations. Finally, we built a formal theory through a process of ex...

Ngày tải lên: 11/08/2014, 05:21

... implementation in healthcare organizations, informed by the implementa- tion of a major patient safety initiative at a large, multi- site, academic hospital in Toronto, Canada. Candidate factors were retained ... Canada, 2 Department of Paediatrics, University of Toronto, Toronto, Canada, 3 Department of Health Policy, Management and Evaluation, University of Toronto, Tor...

Ngày tải lên: 11/08/2014, 05:21

... develop a synoptic MRI report for primary rectal cancer, and to elicit the opinions of radiologists regarding enablers and barriers towards the implementation and sustainability of synop- tic reports ... present and describe key elements or templates for MRI reporting of rectal cancer. Data on type of article, citation, and key criteria will be extracted and tabula...

Ngày tải lên: 11/08/2014, 05:21

... of a model of focal pneumococcal pneumonia in young rats Richard Malley* 1,2 , Anne M Stack 1 , Robert N Husson 2 , Claudette M Thompson 3 , Gary R Fleisher 1 and Richard A Saladino 1,4 Address: ... develop a model of Streptococcus pneumoniae pneumonia in Sprague- Dawley rats. We challenged three-week old Sprague-Dawley pups via intrapulmonary injection of S....

Ngày tải lên: 11/08/2014, 10:23

... information in a tabular, rather than descriptive form. Templates are created specif- ically for a particular setting and can be filled in by the reporting physician. Synoptic reports are of ... is an extremely important area of research, because optimal patient care and clinical outcomes (i.e., risk of local recurrence) require accurate interpretation and doc- umentation of...

Ngày tải lên: 11/08/2014, 16:20

... Access Development of a new ultra sensitive real-time PCR assay (ultra sensitive RTQ -PCR) for the quantification of HBV-DNA Dimitrios Paraskevis 1* , Apostolos Beloukas 1 , Catherine Haida 1 , Antigoni ... [HBsAg(-), HBV-DNA(+)] [15]. The objective of this study was to develop a new ultra sensitive real-time PCR assay based on the knowhow o...

Ngày tải lên: 12/08/2014, 04:20

... locus Koichiro Yamada 1 , Tomonori Tsukahara 1 , Kazuhisa Yoshino 1 , Katsuhiko Kojima 1 , Hideyuki Agawa 1 , Yuki Yamashita 1 , Yuji Amano 1 , Mariko Hatta 1 , Yasunori Matsuzaki 1 , Naoki Kurotori 1 , ... http://www.retrovirology.com/content/6 /1/ 79 Page 9 of 9 (page number not for citation purposes) 11 . Tsukahara T, Agawa H, Matsumoto S, Matsuda M, Ueno S, Yama...

Ngày tải lên: 12/08/2014, 23:22

... Nakasone Y, Ikeda O, Yamashita Y, Kudoh K, Shigematsu Y, Harada K: Shock index correlates with extravasation on angi- ographs of gastrointestinal hemorrhage: a logistic regression analysis. Cardiovasc ... acquisition of data, and data analysis and drafted the manuscript. NS partic- ipated in the design of the study, acquisition of data, and data analysis for the developm...

Ngày tải lên: 13/08/2014, 10:20

... polyclonal anti- body against GFP (Clontech), a monoclonal antibody against the Myc epitope (Sigma), a polyclonal antibody against G pro- tein (Santa Cruz) or an antibody against Hsp70 (Santa Cruz). Bands ... T, Alkalay I, Kronke M., Ben-Neriah Y, Baeuuerle PA: Rapid proteolysis of I kappa B-alpha is necessary for acti- vation of transcription factor NF-kappa B. Nature 1993, 365:18...

Ngày tải lên: 14/08/2014, 14:21