Báo cáo y học: "Use of communities of practice in business and health care sectors: A systematic review" ppt

Báo cáo y học: "Use of communities of practice in business and health care sectors: A systematic review" ppt

Báo cáo y học: "Use of communities of practice in business and health care sectors: A systematic review" ppt

... 4 Canadian Health Services Research Foundation, Ottawa, Canada, 5 Department of Health Policy, Management and Evaluation Faculty of Medicine, University of Toronto, Toronto, Canada and 6 Canadian ... Review Use of communities of practice in business and health care sectors: A systematic review LindaCLi* 1 , Jeremy M Grimshaw 2 , Camilla Nielsen 3 , M...

Ngày tải lên: 11/08/2014, 05:21

9 398 1
Báo cáo y học: "Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia" docx

Báo cáo y học: "Catechol-O-methyltransferase gene haplotypes in Mexican and Spanish patients with fibromyalgia" docx

... as 'sympathetically maintained pain' [5]. Naturally occurring sympathetic neurotransmitters are cate- cholamines known as norepinephrine, epinephrine, and dopamine. All three substances ... fibromyalgia (FM). Heart rate variability analyses have demonstrated signs of ongoing sympathetic hyperactivity. Catecholamines are sympathetic neurotransmitters. Catechol-O-methyltransferase...

Ngày tải lên: 09/08/2014, 10:21

7 428 0
Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot

Báo cáo y học: "Collagen-specific T-cell repertoire in blood and synovial fluid varies with disease activity in early rheumatoid arthritis" pot

... GTCAACAGTCTCCAGAATAAGG BV12 TCCYCCTCACTCTGGAGTC BV1 3A GGTATCGACAAGACCCAGGCA BV13B AGGCTCATCCATTATTCAAATAC BV14 GGGCTGGGCTTAAGGCAGATCTAC BV15 CAGGCACAGGCTAAATTCTCCCTG BV16 GCCTGCAGAACTGGAGGATTCTGG BV17 ... GACATCCGCTCACCAGGCCTG BJ1.1 TCTGGTGCCTTGTCCAAAGAAAGC BJ1.2 CCTGTCCCCGAACCGAAGGTGTA BJ1.3 CCAACTTCCCTCTCCAAAATATAT BJ1.4 CTGGGTTCCACTGCCAAAAAACAG BJ1.5 TCGAGTCCCATCACCAAAATGCTG BJ1.6 CCTGGT...

Ngày tải lên: 09/08/2014, 13:22

18 340 0
Báo cáo y học: " Insights into endocrine-immunological disturbances in autoimmunity and their impact on treatment" doc

Báo cáo y học: " Insights into endocrine-immunological disturbances in autoimmunity and their impact on treatment" doc

... [1,6]. In addition, mild exercise and training and a decrease in the proinflammatory load – as obtained also by the use of anticytokine therapy – can normalize stress axes, leading to favorable responses ... with an increase of activity in the early morning hours, abatement during the day, and a smaller new increase in the early evening [10]. A number of articles hav...

Ngày tải lên: 09/08/2014, 13:22

7 295 0
Báo cáo y học: "PEEP-ZEEP technique: cardiorespiratory repercussions in mechanically ventilated patients submitted to a coronary artery bypass graft surgery" doc

Báo cáo y học: "PEEP-ZEEP technique: cardiorespiratory repercussions in mechanically ventilated patients submitted to a coronary artery bypass graft surgery" doc

... reopen collapsed areas [8,9]. With theairwaypressurizationat 15 cmH 2 O, an increase in functionalresidualcapacity occurs, leading to a reduction in airway resistance and possibly helping on secretion ... protocol was approved by an Ethical Committee and all patients provided informed consent during the preoperative period. Statistical analysis Descriptive analyses are present ed as...

Ngày tải lên: 10/08/2014, 09:22

6 427 0
Báo cáo y học: " Unusual primary HIV infection with colonic ulcer complicated by hemorrhagic shock: a case report" pptx

Báo cáo y học: " Unusual primary HIV infection with colonic ulcer complicated by hemorrhagic shock: a case report" pptx

... angiographic occlusion of a branch of the ileocaecal artery and initiation of antiretroviral therapy, the patient became rapidly asymptomatic and could be discharged. Colonoscopy revealed a bleeding colonic ... may have a variety of symptoms, including flulike syndrome, lym- phadenopathy, gastrointestinal symptoms, pharyngitis, headache, and cutaneous lesions. The non-spec...

Ngày tải lên: 11/08/2014, 07:20

5 375 0
Báo cáo y học: "Use of chinese and western over-the-counter medications in Hong Kong"

Báo cáo y học: "Use of chinese and western over-the-counter medications in Hong Kong"

... role of medical professionals is a dominant factor in defining, controlling and scoping the work of the allied health professionals [21,22] as extending pharma- cists’ roleinprimarycaremayaffecttheautonomyand control ... pharmacist consultations in primary care. Fam Pract 2000, 17(6):480-3. 4. Hassell K, Rogers A, Noyce P: Community pharmacy as a primary health and self...

Ngày tải lên: 25/10/2012, 10:06

9 517 0
Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"

Báo cáo y học: "Use of the measure your medical outcome profile (MYMOP2) and W-BQ12 (Well-Being) outcomes measures to evaluate chiropractic treatment: an observational study"

... for overall health in primary care. There are a number of studies that have evaluated the effectiveness of chiropractic care on patient’s health and general health status as measured by the Short-Form 36 ... change and may be a useful instrument for assessing clinical changes among chiropractic patients who present with a variety of symptoms and clinical condition...

Ngày tải lên: 25/10/2012, 10:06

8 539 0
Báo cáo y học: "No increased risk of infant hypospadias after maternal use of loratadine in early pregnancy"

Báo cáo y học: "No increased risk of infant hypospadias after maternal use of loratadine in early pregnancy"

... finding that maternal use of loratadine in early pregnancy was associated with a roughly doubled risk for infant hypospadias. We concluded: “The finding can still be random, but causality ... study was published based on a prescription register in Denmark which indicated an absence of an association between maternal use of loratadine and an increased risk for hypospadias...

Ngày tải lên: 31/10/2012, 17:03

2 361 0
Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

Tài liệu Báo cáo Y học: Use of site-specific recombination as a probe of nucleoprotein complex formation in chromatin Micha Schwikardi and Peter Droge ¨ potx

... nucleosomal organization. Our analysis employing inhibitors of histone deacetylase and topoisomerases revealed that the reactivity of res remained unaffected, even though the transcriptional activity of ... [14]. Strand exchange is catalyzed by dimers bound at paired sites I, while those bound at sites II and III serve accessory roles in synaptosome formation and in the activa...

Ngày tải lên: 22/02/2014, 07:20

7 473 0
w