Báo cáo y học: "Users'''''''' perspectives of barriers and facilitators to implementing EHR in Canada: A study protocol" pot
Báo cáo y học: "Users'''' perspectives of barriers and facilitators to implementing EHR in Canada: A study protocol" pot
... Québec, Canada and 7 Innovation and Adoption Committee, Canada Health Infoway, Canada Email: Marie-Pierre Gagnon* - marie-pierre.gagnon@fsi.ulaval.ca; Nicola Shaw - nicola.shaw@capitalhealth.ca; ... on barriers and facilitators to the adoption of EHR. Screening and data abstraction All titles and abstracts will be screened independently by a team consisting of one of...
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " User’s perspectives of barriers and facilitators to implementing quality colonoscopy services in Canada: a study protocol" pps
... Québec, Canada. 5 Department of Medicine, Université Laval, Québec, Canada. 6 Canadian Partnership Against Cancer, Québec, Canada. 7 University of Calgary, Calgary, Alberta, Canada. Authors’ ... iterative actions that foster practice upgrading of physicians. Identifying and indexing barriers and facilitators to auditing complica- tions and the level of practice of physic...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo Y học: Functional integration of mitochondrial and hydrogenosomal ADP/ATP carriers in the Escherichia coli membrane reveals different biochemical characteristics for plants, mammals and anaerobic chytrids pdf
... 5¢-TGCAGAGTTCcAtATGGTTGATCAAG-3¢ Antisense 5¢-CGAAAAAAGGAGGAAGAAGCAATGC-3¢ aac2 (A. t.) Sense 5¢-TGTAGAGGTTcAtATGGTTGAACAGACTC-3¢ Antisense 5¢-CTTAATGACTGCGGGATTTGGTGGTAC-3¢ aac3 (A. t.) Sense 5¢-CTGATTTGTACAAcAtATGGATGGATC-3¢ Antisense ... IPTG-induction we were able to obtain functional integration of the various mitochondrial-type AACs into the cytoplasmic membrane of E. coli. Measur...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo y học: "The role of hypoxia and HIF-dependent signalling events in rheumatoid arthritis" ppt
... of α-subunits, and two transactivating domains, namely the amino-terminal transactivating domain and the carboxyl- terminal transactivating domain (C-TAD). The C-TAD has been shown to interact with co-activators ... levels of inflammatory cytokines. The HIF transcription factor family may thus represent an important convergence point in RA, integrating cellular responses to low...
Ngày tải lên: 09/08/2014, 01:22
Báo cáo y học: "Molecular discrimination of responders and nonresponders to anti-TNFalpha therapy in rheumatoid arthritis by etanercept" docx
... excitation and 570 nm emission wave- lengths employing the GeneArray Scanner (Affymetrix, St. Clara, CA, USA). The microarray data were stored according to the MIAME standard and are available ... synovial hyperplasia, and destruction of cartilage and bone. The proinflammatory cytokine TNFα is a key mediator in the pathogenesis of RA [1]. Etanercept (Enbrel ® ; Wyeth, Cambri...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "The role of hypoxia and HIF-dependent signalling events in rheumatoid arthritis" pps
... oxygen-dependent degradation domain, responsible for hypoxic stabilization of α-subunits, and two transactivating domains, namely the amino-terminal transactivating domain and the carboxyl- terminal transactivating ... Oldham NJ, Masson N, Schofield CJ, Ratcliffe PJ: Post- translational hydroxylation of ankyrin repeats in IkappaB pro- teins by the hypoxia-inducible factor (HIF) aspa...
Ngày tải lên: 09/08/2014, 13:22
báo cáo khoa học: " What are possible barriers and facilitators to implementation of a Participatory Ergonomics programme?" docx
... companies (a railway transporta- tion company, an airline company, a university including its university medical hospital, and a steel company) were classified into: mentally, mixed mentally and ... audio taped, transcribed verbatim, and analysed according to a systematic approach. Results: All possible barriers and facilitators were obtained from questionnaire data, indi...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo y học: "The ITGAV rs3738919 variant and susceptibility to rheumatoid arthritis in four Caucasian sample sets" pptx
... Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, Ohtsuki M, Furukawa H, Yoshino S, Yukioka M, Tohma S, Matsubara T, Wakitani S, Teshima R, Nishioka Y, Sekine A, ... A, Iida A, Takahashi A, Tsunoda T, Nakamura Y, Yamamoto K: Functional haplotypes of PADI4, encoding citrullinating enzyme peptidylarginine deimi- nase 4, are associated with rheumatoid arth...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: " Eradication rate of Helicobacter pylori according to genotypes of CYP2C19, IL-1B, and TNF"
... Goto, Takaaki Kondo, Mio Kurata, Kazuko Nishio, Sayo Kawai, Tomo Osafune, Mariko Naito, Nobuyuki Hamajima Department of Preventive Medicine / Biostatistics and Medical Decision Making, Nagoya ... Nagoya University, Nagoya, Japan to seek H. pylori tests and eradication between July 2004 and October 2005. The visitors aged 20 to 69 years were asked to participate in the poly...
Ngày tải lên: 31/10/2012, 16:57
Báo cáo y học: " Transcriptome analysis of murine thymocytes reveals age-associated changes in thymic gene expression"
... (Qiagen, Valencia, CA). Quality and quantity of total RNA samples was assessed us- ing an Agilent 2100 Bioanalyzer (Agilent Technolo- gies, Palo Alto, CA). This total RNA was used to gen- erate ... 4.53 3.3 TTCATCCGTCACAGG AGTCA AGGAATTCGGAGCAGAGAC A chemokine (C-X-C motif) receptor 6 (Cxcr6) NM_030712 Cxcr6 2.49 7.91 3.98 4.7* AACAGCCAGGAGAA CAAACG GGGCAAGTTCAGCAGAAACA decorin...
Ngày tải lên: 03/11/2012, 11:35