Báo cáo y học: "Persistent sciatica induced by quadratus femoris muscle tear and treated by surgical decompression: a case report" docx
... treated by surgical decompression: a case report Artan Bano 1 , Apostolos Karantanas 2 , Dritan Pasku 1* , George Datseris 3 , George Tzanakakis 4 , Pavlos Katonis 1 Abstract Introduction: Quadratus ... groin pain. Br J Sports Med 1997, 31:348-349. doi:10.1186/1752-1947-4-236 Cite this article as: Bano et al.: Persistent sciatica induced by quadratus femoris muscle...
Ngày tải lên: 11/08/2014, 03:21
... groin pain. Br J Sports Med 1997, 31:348-349. doi:10.1186/1752-1947-4-236 Cite this article as: Bano et al.: Persistent sciatica induced by quadratus femoris muscle tear and treated by surgical decompression: ... tomogra- phy (CT)-guided drainage. A surgical exploration of our patient was then performed through a posterolateral approach of the right hip. Intra-op...
Ngày tải lên: 11/08/2014, 07:20
... scanning. Treatment is by surgical repair with a bifurcated graft, a straight tube graft, and endovascular aneurysm repair (EVAR). Usually, cardiac and renal abnormalities are rapidly reversed after ... aneurysm and an aberrant retro-aortic renal vein. Case presentation A 54-year-old Caucasian woman was referred to our emergency department for heart failure associated with d...
Ngày tải lên: 11/08/2014, 03:21
Báo cáo y học: "Aorto-venous fistula between an abdominal aortic aneurysm and an aberrant renal vein: a case report" pps
... aneurysm and an aberrant retro-aortic renal vein. Case presentation A 54-year-old Caucasian woman was referred to our emergency department for heart failure associated with dyspnea and bilateral ... of a woman with a fistula betwe en an infra-renal aortic aneurysm and an aberrant retro-aortic left renal vein. Aorto-venous fistulas may be asymptomatic or may present with symptoms...
Ngày tải lên: 11/08/2014, 07:20
Báo cáo y học: "F-fluorodeoxyglucose positron emission tomography-positive sarcoidosis after chemoradiotherapy for Hodgkin’s disease: a case report." ppsx
... of 18 F-FDG-avid lymphadenopathy in the left cervical and supraclavicular nodes but new bilateral 18 F-FDG-avid pulmonary hilar and mediastinal lymphadenopathy. Cherk et al. Journal of Medical Case Reports ... aphy scan. (A) Pr ominent physiological brown fat uptake in the neck and thorax. (B and C) 18 F-FDG-avid lymphadenopathy in the left lower cervical nodes. (D and E) 18 F-FDG...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo y học: " Renal cell carcinoma metastasis to the ciliary body responds to proton beam radiotherapy: a case report" pptx
... was diagn osed as acute a ngle-closure glaucoma (AACG) secondary to a ciliary body mass in his right eye. He was started on timolol, acetazolmide, and latanoprost followed by a YAG (yttrium aluminium garnet) ... JOURNAL OF MEDICAL CASE REPORTS Renal cell carcinoma metastasis to the ciliary body responds to proton beam radiotherapy: a case report Alasil et al. Alasil et al. Jou...
Ngày tải lên: 10/08/2014, 23:22
Báo cáo khoa học: "Diffuse anorectal melanoma; review of the current diagnostic and treatment aspects based on a case report" doc
... report a case of a 57-year-old man with a diffuse anal canal melanoma and give reference to the current diagnostic and treatment options. Introduction Malignant melanoma of the anal canal accounts ... anorectal melanoma is a rare and aggressive disease. Patients commonly complain for changes in bowel habits and rectal bleeding, and proctoscopically they mostly appear as no...
Ngày tải lên: 09/08/2014, 04:21
Báo cáo y học: " Cellular stress-induced up-regulation of FMRP promotes cell survival by modulating PI3K-Akt phosphorylation cascades" pdf
... error of mean (S.E.M.) and analyzed for statistical significance by using one way analysis of variance (ANOVA) followed by Newman-Keuls test as a post hoc test and a p value < 0.01 was considered ... loop, and antisense strands as follows: CCGG GCGTTTGGAGAGATTACAAATCTCGAG- ATTTGTAATCTCTCCAAACGCTTTTT As a control, non-target shRNA co ntrol vector was used (Sigma, SHC002) an...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo Y học: The role of arginine residues in substrate binding and catalysis by deacetoxycephalosporin C synthase potx
... The Department of Pharmacy and Pharmacology, The University of Bath, Claverton Down, Bath BA2 7AY, UK. Fax: + 44 1225 386114, E-mail: M.D.Lloyd@bath.ac.uk Abbreviations: DAC, deacetylcephalosporin ... subsequent hydroxyla- tion of DAOC to give deacetylcephalosporin C (DAC 3)is catalysed by a closely related oxygenase, deacetylcephalo- sporin C synthase (DACS; Swissprot P42220). The DAC...
Ngày tải lên: 18/03/2014, 01:20
Báo cáo y học: " Augmentation of Pulmonary Epithelial Cell IL-8 Expression and Permeability by Pre-B-cell Colony Enhancing Factor" docx
... Band density on Western blot images was used as a measure of assayed protein level. The band image was acquired using an Alpha Imager and analyzed by the AlphaEase™ Stand Alone Software. In Vitro ... forward primer, 5'- TTAGAATTC GCCACCATGCCTGCGGCAGAAGCC-3&apos ;and reverse primer, 5'-TTAGAATTC TTAATGGTGATGGTGAT- GATGCAAATGATGTGCTGCTTCCAGTTC-3'. The regular bold letters...
Ngày tải lên: 11/08/2014, 08:22