Báo cáo y học: "Small interfering RNA mediated Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell line" pptx
... RESEARC H Open Access Small interfering RNA mediated Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell line Rajesh K Aneja 1* , Hanna Sjodin 2 , ... Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell line. Journal of I...
Ngày tải lên: 11/08/2014, 03:20
... 8:3 http://www.journal-inflammation.com/content/8/1/3 Page 6 of 9 RESEARC H Open Access Small interfering RNA mediated Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast cell ... Poly (ADP-ribose) Polymerase-1 inhibition upregulates the heat shock response in a murine fibroblast...
Ngày tải lên: 11/08/2014, 06:22
... 1. The VNS therapy device and leads were surgically implanted on February 26, 1999. After recovery, the Table 1: Baseline Physical and Clinical Characteristics of the Patient Characteristic Age ... women and neo- natal withdrawal syndrome: a database analysis. Lancet 2005, 365(9458):482-487. Table 2: Vagus Nerve Stimulation Therapy Parameter Values Parameter Value March 17, 1999 (beg...
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Lack of association between mannose-binding lectin gene polymorphisms and juvenile idiopathic arthritis in a Han population from the Hubei province of China" docx
... of 315 base pairs (bp) was amplified using the following primers: 5'-ATAGCCTGCAC- CCAGATTGTAG-3' (forward primer) and 5'-AGAGACA- GAACAGCCCAACAC-3' (reverse primer). The PCRs ... 11.0; SPSS Inc., Chi- cago, IL, USA) was used to analyze the data. Results Findings in healthy controls The distribution of codon 54 gene polymorphisms in healthy Han-nationality Chine...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Association of reduced heme oxygenase-1 with excessive Toll-like receptor 4 expression in peripheral blood mononuclear cells in Behçet''''s disease" potx
... TGACTGCTCGGAGTTCTCCC Antisense GTCAGCACCAGAGCCTGGAG TLR4 Sense GCGGCTCGAGGAAGAGAAGA Antisense AGGCTCTGATATGCCCCATC GAPDH Sense ACAGTCAGCCGCATC Antisense AGGTGCGGCTCCCTA TNF-α Sense ATGAGCACTGAAAGCATGATC Antisense ... Natl Acad Sci USA 1997, 94:10925-10930. 23. Yachie A, Niida Y, Wada T, Igarashi N, Kaneda H, Toma T, Ohta K, Kasahara Y, Koizumi S: Oxidative stress causes enhanced endothelia...
Ngày tải lên: 09/08/2014, 10:22
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps
... NKG2D and its MIC ligands in rheumatoid arthritis. Proc Natl Acad Sci USA 2003, 100:9452-9457. 13. Kochi Y, Yamada R, Kobayashi K, Takahashi A, Suzuki A, Sekine A, Mabuchi A, Akiyama F, Tsunoda T, ... 46:426-430. 15. Martinez A, Fernandez-Arquero M, Balsa A, Rubio A, Alves H, Pas- cual-Salcedo D, Martin-Mola E, de la Concha EG: Primary asso- ciation of a MICA allele with protecti...
Ngày tải lên: 09/08/2014, 14:20
Báo cáo y học: "Barriers to access prevention of mother-to-child transmission for HIV positive women in a well-resourced setting in Vietnam" pptx
... collection and the data analysis. PW conceived of the study and participated in its design and coordination. AH participated in the study design, the data analysis, and coordination. All authors read and approved ... contributions TAN participated in the design of the study, conduct the data collection and the dada analysis. PO participated in the design of the stu...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Eyes wide shut - unusual two stage repair of pectus excavatum and annuloaortic ectasia in a 37 year old marfan patient: case report." pdf
... with aortic cannulation of the arch and venous cannulation using a two-stage cannula placed into the right atrium cardiopulmonary bypass was started. The ascending aort a was distally crossclamped ... excavatum and an annuloaortic ectasia in a 37 Figure 1 Initial CT-scan showing the pectus excavatum. Figure 2 X-ray at r eadmission. Red Arrows indicating the crack and disloca...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx
... cirrhosis was great. They are also the main cause of hepa tocellular carcinoma [8]. The HCV RNA genotype in this patient was 2a, a favorable factor for anti-HCV therapy [9,10]. Attempts have been made to ... hospital visit, and his antibody against HCV was positive three years after the initiation of hemodialysis. His HBV DNA was assayed twice seven years later. The results of h...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo y học: "Use of near-infrared light to reduce symptoms associated with restless legs syndrome in a woman: a case repor" ppt
... Physiology, Pathophysiology, and Pharmacology. Pharmacol Rev 1991, 43(2):109-142. 23. Hawkins D, Abrahamse H: Phototherapy - a treatment modality for wound healing and pain relief. African Journal ... of this case report and any accompanying images. A copy of the written consent is available for review by the Editor -in- Chief of this journal. Competing interests The author declares...
Ngày tải lên: 11/08/2014, 03:21