Báo cáo y học: " Loss of function mutation in toll-like receptor-4 does not offer protection against obesity and insulin resistance induced by a diet high in trans fat in miceg" pdf

... protection against obesity and insulin resistance induced by a diet high in trans fat in mice. Journal of Inflammation 2011 8:2. Submit your next manuscript to BioMed Central and take full advantage of: ... saturated fat -induced TLR4 signaling pathway is a likely mechan- ism linking dietary fat with inflammation and insulin resistance associate...

Ngày tải lên: 11/08/2014, 03:20

... protection against obesity and insulin resistance induced by a diet high in trans fat in mice. Journal of Inflammation 2011 8:2. Submit your next manuscript to BioMed Central and take full advantage of: ... signaling by trasducing pro- duction of proinflammatory markers in macrophages, adipocytes, and liver leading to insulin resistance. Insu- lin...

Ngày tải lên: 11/08/2014, 06:22

... loss of binding affinity observed in radioligand binding assays (Fig. 6B). This reduced affinity for NDP-MSH of the Glu94Arg variant was evident by a Fig. 6. Functional analysis of an artificial MC1R ... intracellular signaling pathways [16]. As a result of MC1R activation, the activity of the rate-limiting enzyme in melanin synthe- sis, tyrosinase, is increased and skin...

Ngày tải lên: 17/03/2014, 10:20

... provided platypus and echidna sam- ples. All authors read and approved the final manuscript. Additional data files The following additional data files are available. Additional data file 1 is a figure ... bp) GACTCTCTGAATGGGAAGTCATTTTGCATCACCT LINE2 SINE LINE2 TCCAGTGGATTATAGGGAATAACTTCACTGGGCAGTTTTATTCCATCTTTGATCATGGGAATAACTTTGTTGGAATTGC CCCAATTATTCCTTAG SINE DSLNGKSFC WIIGNNFTGQFYSIFD...

Ngày tải lên: 14/08/2014, 08:21

... coat/hilum phenotype in soybean. Background Domestication of Soybean Soybean [Glycine max (L.) Merr.] is a remarkable plant, producing both high quality oil and protein and is one of the primary ... anthocyanins to seed coats. Thoug h hypothetical, this may represent a viable, alternate means to visually select for transgene integration and/ or a visual means to assist in...

Ngày tải lên: 11/08/2014, 11:21

... methacholine (MCh), namely increased lung resistance (measured plethysmographi- cally) and decreased dynamic compliance, a correlate of the ability of the airways to recoil after the release of air pressure ... (to E.W.G.). References Articles of particular interest have been highlighted as: • of special interest •• of outstanding interest 1. Saito H, Kranz DM, Takagaki Y,...

Ngày tải lên: 12/08/2014, 18:20

... glucose (FBG), insulin, triglyceride (TG), cholesterol (CHOL), ALT, aspartate amino- transferase (AST), γ-glutamyltransferase (GGT), alka- line phosphatases (ALP), albumin (Alb) and globulin (Glb) ... recruited into this study. The levels of fasting blood glucose (FBG), fasting insulin (FINS), triglyceride (TG), cholesterol (CHOL), alanine amino- transferase (ALT), aspartate aminotr...

Ngày tải lên: 25/10/2012, 11:48

... Transplantation at Cedars-Sinai Medical Center. His basic and translational research interests involve the immunological and inflammatory mechanisms of pathogenesis in alloimmune and autoimmune ... contributing to the efficacy of combination LAM and HBIG remain poorly defined. Postulated mechanisms include the synergy of: 1) LAM reducing HBV replication and altering synth...

Ngày tải lên: 02/11/2012, 11:17

... containing fatty acids with a particular chain length and unsaturation pattern, and that the MU treatment of cells decreases the availability of these favorable CL species. Additionally, the interaction ... Shinomura, T., Hamaguchi, M., Yoshida, Y. , Ohnuki, Y. , Miyauchi, S., Spicer, A. P., McDonald, J .A. & Kimata, K. (1999) Three isoforms of mammalian hyaluronan synthase...

Ngày tải lên: 08/03/2014, 09:20

... flavin position is also marginally altered by the substitution of Y2 38 (Table 2). Steady-state and rapid reaction kinetics with D -alanine The ability of the Y2 38 mutants to catalyse D -alanine/ oxygen ... half-reaction of Y2 38 mutants with D -alanine was measured by mixing anaerobically a solution of each mutant enzyme with solutions containing varying concen- trations...

Ngày tải lên: 17/03/2014, 17:20