Báo cáo y học: "Extracorporeal immune therapy with immobilized agonistic anti-Fas antibodies leads to transient reduction of circulating neutrophil numbers and limits tissue damage after hemorrhagic shock/resuscitation in a porcine model" doc

Báo cáo y học: "Extracorporeal immune therapy with immobilized agonistic anti-Fas antibodies leads to transient reduction of circulating neutrophil numbers and limits tissue damage after hemorrhagic shock/resuscitation in a porcine model" doc

Báo cáo y học: "Extracorporeal immune therapy with immobilized agonistic anti-Fas antibodies leads to transient reduction of circulating neutrophil numbers and limits tissue damage after hemorrhagic shock/resuscitation in a porcine model" doc

... properly cited. Research Extracorporeal immune therapy with immobilized agonistic anti-Fas antibodies leads to transient reduction of circulating neutrophil numbers and limits tissue damage after ... again. Catheters were reconnected and after a steady-state stabilization period of 30 minutes hemodynamic parameters were examined for 15 minutes....

Ngày tải lên: 11/08/2014, 03:20

13 375 0
Báo cáo y học: "Extracorporeal cell therapy of septic shock patients with donor granulocytes: a pilot study" doc

Báo cáo y học: "Extracorporeal cell therapy of septic shock patients with donor granulocytes: a pilot study" doc

... significant increase in platelets and antithrombin III (not shown); significant reduction in noradrenaline use (Figure 6); significant reduction in alanine transaminase, aspartate transaminase and creatinine ... Germany) and citrate in a cell separator (COBE Spectra, Gambro BCT, Planegg-Martinsried, Germany) according to standard procedures. Because of the delay due t...

Ngày tải lên: 14/08/2014, 07:21

13 484 0
Báo cáo y học: "Successful rescue therapy with tenofovir in a patient with hepatic decompensation and adefovir resistant HBV mutant" ppt

Báo cáo y học: "Successful rescue therapy with tenofovir in a patient with hepatic decompensation and adefovir resistant HBV mutant" ppt

... lami- vudine and 13 months after having stopped pegylated interferon, HBV-DNA rose to 8.3 log 10 , ALT to 10 ULN and aspartate aminotransferase to 7 ULN. Prothrombin time was 78%, and total bilirubin ... interpret the data and partici- pated in the writing of the manuscript. Yves Benhamou and Thierry Poynard helped interpret the data and criti- cally revised the manusc...

Ngày tải lên: 13/08/2014, 13:20

4 218 0
Báo cáo y học: "Is Obesity Associated with an Increased Risk for Airway Hyperresponsiveness and Development of Asthma" pdf

Báo cáo y học: "Is Obesity Associated with an Increased Risk for Airway Hyperresponsiveness and Development of Asthma" pdf

... the airway smooth muscles and hence increased airways resistance and methacholine reactivity. Therefore, obese patients complain of more dyspnea and asthma-like symptoms than leaner patients and ... for class III. Obesity was found to be associated with AHR and appears to be a risk factor for asthma. Key words: airway hyperresponsiveness, asthma, obesity R ecently, asthma...

Ngày tải lên: 08/08/2014, 21:20

8 417 0
Báo cáo y học: " HIV-1 recombinants with multiple parental strains in low-prevalence, remote regions of Cameroon: Evolutionary relics?" pot

Báo cáo y học: " HIV-1 recombinants with multiple parental strains in low-prevalence, remote regions of Cameroon: Evolutionary relics?" pot

... genome was amplified using MSF12b (5'-AAATCTCTAGCAGT- GGCGCCCGAACAG) and OFMR1 (5'-TGAGG- GATCTCTAGTTACCAGAGTC), followed by F2nst (5'- GCGGAGGCTAGAAGGAGAGAGATGG) and ofm19 (5'-GCACTCAAGGCAAGCTTTATTGAGGCTTA). PCR ... Militaire de Yaoundé, Yaounde, Cameroon, 6 Global AIDS Program, CDC, Atlanta, GA, USA, 7 Bill and Melinda Gates Foundation, Seattle, WA, USA and...

Ngày tải lên: 12/08/2014, 23:23

8 188 0
Báo cáo y học: " Endothelial Postresuscitation care with mild therapeutic hypothermia and coronary intervention after out-of-hospital cardiopulmonary resuscitation: a prospective registry analysi" pot

Báo cáo y học: " Endothelial Postresuscitation care with mild therapeutic hypothermia and coronary intervention after out-of-hospital cardiopulmonary resuscitation: a prospective registry analysi" pot

... 24:179-186. 39. Kajino K, Iwami T, Daya M, Nishiuchi T, Hayashi Y, Kitamura T, Irisawa T, Sakai T, Kuwagata Y, Hiraide A, Kishi M, Yamayoshi S: Impact of transport to critical care medical centers ... S, Angquist KA, Young M: Efficacy of bystander CPR: intervention by lay people and by health care professionals. Resuscitation 2005, 66:291-295. 5. Iwami T, Kawamura T, Hiraide A, Be...

Ngày tải lên: 14/08/2014, 07:21

10 364 0
Báo cáo y học: "Mycobacterial immune reconstitution inflammatory syndrome in HIV-1 infection after antiretroviral therapy is associated with deregulated specific T-cell responses: Beneficial effect of IL-2 and GM-CSF immunotherapy" pptx

Báo cáo y học: "Mycobacterial immune reconstitution inflammatory syndrome in HIV-1 infection after antiretroviral therapy is associated with deregulated specific T-cell responses: Beneficial effect of IL-2 and GM-CSF immunotherapy" pptx

... purposes) Journal of Immune Based Therapies and Vaccines Open Access Original research Mycobacterial immune reconstitution inflammatory syndrome in HIV-1 infection after antiretroviral therapy is associated ... under- lying MAC infection despite receiving conventional anti- MAC treatment, and were given IL-2 and GM-CSF in con- junction with ART as salvage therapy as d...

Ngày tải lên: 11/08/2014, 10:23

11 365 0
Báo cáo y học: "Cognitive remediation therapy for patients with anorexia nervosa: preliminary findings" pptx

Báo cáo y học: "Cognitive remediation therapy for patients with anorexia nervosa: preliminary findings" pptx

... con- sidered to be a core component to the pathology of AN, maintaining cycles of AN as well as being an obstacle to patients benefiting and completing more emotionally driven psychological treatments ... therapy for patients with anorexia nervosa: preliminary findings Kate Tchanturia*, Helen Davies and Iain C Campbell Address: Section of Eating Disorders, Institute of...

Ngày tải lên: 08/08/2014, 21:20

6 386 0
Báo cáo y học: "Hormone replacement therapy in rheumatoid arthritis is associated with lower serum levels of soluble IL-6 receptor and higher insulin-like growth factor 1" doc

Báo cáo y học: "Hormone replacement therapy in rheumatoid arthritis is associated with lower serum levels of soluble IL-6 receptor and higher insulin-like growth factor 1" doc

... study and after 12 and 24 months, using vaginal ultrasonography and cytology. E 2 in serum was measured (approximately 12 hours after tablet intake) by radioimmunoassay (Clinical AssaysTM, DiaSorin, ... Kameda T, Mano H, Yuasa T, Mori Y, Miyazawa K, Shiokawa M, Nakamaru Y, Hiroi E, Hiura K, Kameda A, Yang NN, Hakeda Y, Kumegawa M: Estrogen inhibits bone resorption by directly...

Ngày tải lên: 09/08/2014, 01:21

8 456 0
w