báo cáo khoa học: "An 82-year-old Caucasian man with a ductal prostate adenocarcinoma with unusual cystoscopic appearance: a case report" ppsx

... integrates extractive text summariza- tion methods such as LexRank (Erkan and Radev, 2004). Highlighting Keyphrases Another approach to assist users in better grasping the idea of a wiki page at a ... Re- search, 22:457–479. David Ferrucci and Adam Lally. 2004. UIMA: An Ar- chitectural Approach to Unstructured Information Pro- cessing in the Corporate Research Environment. Nat- ural Langu...

Ngày tải lên: 07/03/2014, 22:20

... dermaseptin S9. FEBS J 275, 4134–4151. 41 Simmaco M, Mangoni ML, Boman A, Barra D & Boman HG (1998) Experimental infections of Rana esculenta with Aeromonas hydrophila: a molecular mechanism ... ThT-binding capabil- ity, similar to the metastable aggregates of aDrs. Inter- estingly, the same behaviour was observed for a C-terminally amidated aDrs (aDrsa) (data not shown). However,...

Ngày tải lên: 23/03/2014, 04:20

... CAS E REP O R T Open Access An 82-year-old Caucasian man with a ductal prostate adenocarcinoma with unusual cystoscopic appearance: a case report Stavros Sfoungaristos 1 , Ioannis S Katafigiotis 2* , ... Katafigiotis 2* , Stavros I Tyritzis 2 , Adamantios Kavouras 1 , Panagiotis Kanatas 3 , Anastasios Petas 4 Abstract Introduction: Ductal adenocarcinoma is a...

Ngày tải lên: 11/08/2014, 02:22

... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCA...

Ngày tải lên: 14/02/2014, 14:20

... Authors Journal compilation ª 2009 FEBS 127 An anthrax lethal factor mutant that is defective at causing pyroptosis retains proapoptotic activity Stephanie Ngai, Sarah Batty, Kuo-Chieh Liao and Jeremy ... K518E and E682G (Fig. 1A) . Lys518 is within a patch of amino acids that has previously been implicated in binding MAPKKs [22]. Glu682 is within an a- helix that also contains the amino a...

Ngày tải lên: 16/02/2014, 09:20

... intramolecular interactions, allowing access to the AD. As the autoinhibition affected an unrelated AD when this was put in place of the native Meis2d AD, it appears that any intramolecular interac- tions ... The Authors Journal compilation ª 2010 FEBS L3 -A mutant with Pbx 1a was reduced by at least as much as that of the previously described LL-AA mutant. Additionally, the EEK -A mutan...

Ngày tải lên: 16/02/2014, 15:20

... 5¢-GAATTCTAATAC GACTCAGAATGAGTCTGGGCCTCTTTTTAAGAAC-3¢; 8–17 variant DNAzyme, 5¢-AATACTCCGAGCCGGTCG GGCCTC-3¢; DRc DNAzyme, 5¢-GAATTCTAATACTCC GAGCCGGTCGGGCCTCTTTTTAAGAAC-3¢) were pre- pared by automated ... including the ease of RNA substrate and DNAzyme synthesis without any chemical modification, and convenient use of RNase A as a common bioreagent, an attractive property for DNAzymes th...

Ngày tải lên: 16/02/2014, 15:20

... Entomol 51, 1–24. 7 Nagasawa H, Kataoka H, Isogai A, Tamura S, Suzuki A, Mizoguchi A, Fujiwara Y, Suzuki A, Takahashi SY & Ishizaki H (1986) Amino acid sequence of a protho- racicotropic hormone ... insects. Experimental procedures Animals A racial hybrid of B. mori, Kinshu · Showa (Ueda Sanshu, Ueda, Japan), was used. Larvae were reared as previously described [38]. Pupae initiat...

Ngày tải lên: 18/02/2014, 13:20

... migrated as a single band on SDS–PAGE, with an apparent molecular mass of 57–59 kDa, depending on the acryl- amide concentration used (Fig. 1A) . Western blotting analyses of the intact as well as ... E & Hisabori T (2001) ATP synthase – a marvellous rotary engine of the cell. Nat Rev Mol Cell Biol 2, 669–677. 4 Sambongi Y, Iko Y, Tanabe M, Omote H, Iwamoto- Kihara A, Ueda I, Yanag...

Ngày tải lên: 18/02/2014, 17:20

... colon carcinoma and rectal carcinoma as compared to normal colonic tissue. Colon carcinoma cells, rectal carcinoma cells and their normal healthy tissue counterparts were harvested ( 1a, carcinoma ... membrane-blebbing assay, we evaluated the activity of the mutant with the tail deletion (Flag-TD; s-DAPK- 1Dtail) and the protease-resistant substitution (Flag- TM1; s-DAPK-1G296AR29 7A) . As...

Ngày tải lên: 18/02/2014, 17:20