báo cáo khoa học: " Granulomatous infiltration of a parathyroid adenoma presenting as primary hyperparathyroidism in a woman: a case report" ppt
... 21:438-441. doi:10.1186/1752-1947-4-400 Cite this article as: Anaforoğlu et al.: Granulomatous infiltration of a parathyroid adenoma presenting as primary hyperpara thyroidism in a woman: a case report. Journal of Medical Case Reports ... Medical Case Reports 2010, 4:400 http://www.jmedicalcasereports.com/content/4/1/400 Page 4 of 4 CASE REPO R T Open Ac...
Ngày tải lên: 11/08/2014, 02:22
... Case presentation A 64-year-old Caucasian man was admitted to our hos- pital with a ten- year-history of a mild diffus e abdominal pain associated with anorexia. He reported no noticeable weight ... mesentery, intestinal transplan tation has been performed [17]. It is generally easy to diagnose primary IAF in its clas- sic presentation as a mesenteric mass, because of its...
Ngày tải lên: 11/08/2014, 02:21
... Ewing’s sarcoma (EWS) oncogene contains an N-terminal transcrip- tion activation domain and a C-terminal RNA-binding domain. Although the EWS activation domain is a potent transactivation domain ... pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC T), for pGEX–EAD; RGG1 forward d(CGG AAT TCC CAG GAG AGA ACC GGA GCA T)...
Ngày tải lên: 15/02/2014, 01:20
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
... Thermoplasma volcanium. Proc.NatlAcad.Sci.USA97, 14257–14262. 49. Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Hai- kawa,Y.,Jin-n.,o,K.,Takahashi,M.,Sekine,M.,Baba,S., Ankai, A. , Kosugi, ... mixing. After 1 min, 100 lL34%citrate was added a nd mixed. This solution was read immediately at 660 nm. In an alternative assay, the ATPase activity of PfPDO was assayed in mixtures...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Enzymatic actions of Pasteurella multocida toxin detected by monoclonal antibodies recognizing the deamidated a subunit of the heterotrimeric GTPase Gq potx
... PMT with an increase in intracellular inositol phos- phates, indicating the activation of PLCb downstream of Ga q or Ga 11 . Furthermore, PMT increased the migration of Ga 11 protein in native gel ... sug- gest that the catalytic triad in the C3 domain conducts the deamidation reaction. However, the enzymatic characteristics of PMT have not been analyzed as a result of the...
Ngày tải lên: 22/03/2014, 16:20
Báo cáo khoa học: Crystal structure of the halotolerant c-glutamyltranspeptidase from Bacillus subtilis in complex with glutamate reveals a unique architecture of the solvent-exposed catalytic pocket docx
... potential. The water- binding capacities of glutamate and aspartate have been reported to be 7.5 and 6.0 molecules per amino acid, respectively, whereas those for asparagine, serine and threonine have ... 5¢- CATATGGATGAGTACAAACA AGTAGATG-3¢ and reverse primer 5¢- GGATCCTCGAG CTCATTTACGTTTTAAATTAATGCCGAT-3¢ (underlin- ed sequences indicate NdeI and BamHI sites, respectively). The PCR produc...
Ngày tải lên: 22/03/2014, 21:20
Báo cáo khoa học: "Comparative studies of the water relations and the hydraulic characteristics in Fraxinus excelsior, Acer pseudoplatanus and A. opalus trees under soil water contrasted conditions Damien Lemoinea, Jean-Paul Peltierb and Gérard" pdf
... full capacity of the water conducting vessels. At this stage, some free water ap- pears at the stomata level. The leaf was then fixed on a plate of an analytical balance and the water flow was in- duced ... trendappeared to be a general pattern for ash trees, as indicated by simi- lar diurnal ψ w curves on expanding leaves determined in other years [10]. In contrast to ash lea...
Ngày tải lên: 08/08/2014, 14:21
Báo cáo khoa học: "Surgical outcomes of borderline breast lesions detected by needle biopsy in a breast screening program" ppsx
... women had undergone needle biopsy in Breastscreen ACT&SENSW and either atypical ductal hyperplasia (ADH), flat epithelial atypia (FEA), atypical lobular hyperplasia (ALH), radial scar/complex ... manuscript. Authors’ information KMF has been a breast physician since 1989 and is a Fellow of the Australasian Society of Breast Physicians. AMB is the Clinical Director of the regio...
Ngày tải lên: 09/08/2014, 03:22
Báo cáo khoa học: "Early prediction of response to radiotherapy and androgen-deprivation therapy in prostate cancer by repeated functional MRI: a preclinical study" pptx
... obtained in a preclinical study in prostate cancer xenografts, and suggest that the combination of functional MRI parameters, in addition to standard clinical parameters, increases the power of predicting ... apply the same approach in a clinical setting, including parameters from functional MRI, as well as standard clinical parameters, from PCa patients recei ving ADT and...
Ngày tải lên: 09/08/2014, 09:20
báo cáo khoa học: " Simultaneous detection of Human Immunodeficiency Virus 1 and Hepatitis B virus infections using a dual-label time-resolved fluorometric assay" potx
... the assay was evaluated using a collection (n = 60) of in- house and commercially available human sera panels. This evaluation showed the dual-label assay to possess high degrees of specificity and ... Sheikh M Talha 2† , Sathyamangalam Swaminathan 2 , Raija Vainionpää 3 , Tero Soukka 1 , Navin Khanna 2 , Kim Pettersson 1* Abstract A highly specific and novel dual-label time-resolved...
Ngày tải lên: 11/08/2014, 00:22