báo cáo khoa học: " Benign cystic mesothelioma of the append

báo cáo khoa học: " Benign cystic mesothelioma of the appendix presenting in a woman: a case report" potx

... Access Benign cystic mesothelioma of the appendix presenting in a woman: a case report Donal B O’Connor * , David Beddy, Muyiwa A Aremu Abstract Introduction: Benign cystic mesothelioma or peritoneal ... Irish Caucasian woman presented to the hospital with a three-day history of abdominal pain and fever. The pain was gradual in onset and associated wi...

Ngày tải lên : 11/08/2014, 02:22

4
216
0

Báo cáo khoa học: "Adenoid cystic carcinoma of the peripheral lung: a case report" potx

... k1111@asahikawa-med.ac.jp 1 Department of Surgery, Asahikawa Medical University, Midorigaoka-Higashi 2-1-1-1 Asahikawa Hokkaido 078-8510, Japan Full list of author information is available at the end of the ... Tokusashi 2 , Naoyuki Miyokawa 2 , Tadahiro Sasajima 1 Abstract Adenoid cystic carcinoma of the peripheral lung is a rare entity. We recently encountered a patient...

Ngày tải lên : 09/08/2014, 03:22

4
426
0

Báo cáo khoa học: "Mucinous cystic neoplasms of the mesentery: a case report and review of the literature" pdf

... macrocystic transformation resembling ovarian mucinous cystadenocarcinoma in a case of synchronous bilateral infiltrating ductal carcinoma. Pathol Int 2008, 58(9):601-5. 48. Morinaga S, Ohyama R, Koizumi ... PP and IP collected case details and helped in the literature search and drafting of the manuscript. All authors read and approved the final manuscript. Appendix...

Ngày tải lên : 09/08/2014, 04:21

8
659
0

Báo cáo khoa học: DNA-binding characteristics of the regulator SenR in response to phosphorylation by the sensor histidine autokinase SenS from Streptomyces reticuli doc

... upstream of furS) IEcorev CGAGAATTCGAAAACGAACGGTGC (located upstream of furS and ending at the 5¢-end of binding site I) B IEcofor GTTGAATTCTCGTGTTTATGAGGG (located upstream of furS and beginning at ... (5¢-CGACGACACCGGCACC GA-3¢) and S2c (5¢-CGGGGCCAGGACGACGAGCA-3¢). Each of the fragments was end-labeled with [ 32 P]ATP[cP] using T4 polynucleotide kinase. An aliquot of the...

Ngày tải lên : 07/03/2014, 10:20

14
428
0

Báo cáo khoa học: Expression and characterization of the protein Rv1399c from Mycobacterium tuberculosis A novel carboxyl esterase structurally related to the HSL family docx

... functional catalytic triad made of a catalytic nucleophile serine, associated to a proton c arrier histidine and a c harge r elaying aspartic (or glutamic) acid. To further investigate the biochemical ... (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. 12. Vincentelli, R., Canaan, S., Campanacci, V., Valencia...

Ngày tải lên : 07/03/2014, 16:20

9
584
0

Báo cáo khoa học: Electron-transfer subunits of the NiFe hydrogenases in Thiocapsa roseopersicina BBS pptx

... hydrogenase was substantially decreased in the DhupC (HCMG4) strain. At the same time, the in vitro activity was twice as high as that of the strain harbouring HupC (Table 5). A comparison of the hupSL ... USA) [34]. The plates were incubated in anaerobic jars by means of the AnaeroCult (Merck, Darmstadt, Germany) system for 2 weeks. The E. coli strains were main...

Ngày tải lên : 16/03/2014, 03:20

11
390
0

Báo cáo khóa học: NUB1-mediated targeting of the ubiquitin precursor UbC1 for its C-terminal hydrolysis potx

... resulting in the loss of a UBL domain. Using these mutants and a wild-type NUB1, we then examined the interaction with UbC1 in yeast cells. In the assay, UbC1 fused to the Gal4 DNA-activation domain ... and/or an N-terminal deletion. For example, M1 had a C-terminal deletion from Lys371 to Asn601, resulting in the loss of two UBA domains (UBA1 and UBA3) and a PES...

Ngày tải lên : 23/03/2014, 12:20

11
425
0

Báo cáo khoa học: "Small cell carcinoma of the appendix" pot

... presentation of ESC carcinoma is usually at an advanced stage due to the aggressive nature of the disease. Therapeutic modalities are determined by the location and extent of disease. Chemotherapy remains the ... confirming a primary small cell carcinoma of her appendix. Conclusion: This is the first reported case of a pure extrapulmonary carcinoma arising from th...

Ngày tải lên : 09/08/2014, 07:21

4
383
0

Báo cáo khoa học: "Solitary fibrous tumor of the pleura presenting with syncope episodes when coughing" docx

... University of Milan, Fondazione Ospedale Maggiore Policlinico, Mangiagalli e Regina Elena, IRCCS, Milan, Italy and 4 A. O. San Paolo, U.O. Anatomia Patologica, Milan, Italy Email: Luigi Santambrogio ... course, the malignant form has also been reported. Case presentation: We herein describe a case of 72 year-old man with head, facial, and thoracic traumas caused by neurally-med...

Ngày tải lên : 09/08/2014, 07:21

5
299
0

Báo cáo khoa học: " Linkage disequilibrium pattern of the ATM gene in breast cancer patients and controls; association of SNPs and haplotypes to radio-sensitivity and post-lumpectomy local recurrence" doc

... protein contains several impor- tant domains such as 1) the C-terminal protein kinase domain (PI3K-domain), 2) the substrate binding domain in the N-terminal of the protein necessary for activation ... Corresponding author Abstract Background: The ATM protein is activated as a result of ionizing radiation, and genetic variants of the ATM gene may therefore affect the...

Ngày tải lên : 09/08/2014, 10:21

9
450
0