báo cáo khoa học: " Benign cystic mesothelioma of the appendix presenting in a woman: a case report" potx

... Access Benign cystic mesothelioma of the appendix presenting in a woman: a case report Donal B O’Connor * , David Beddy, Muyiwa A Aremu Abstract Introduction: Benign cystic mesothelioma or peritoneal ... Irish Caucasian woman presented to the hospital with a three-day history of abdominal pain and fever. The pain was gradual in onset and associated wi...

Ngày tải lên: 11/08/2014, 02:22

... k1111@asahikawa-med.ac.jp 1 Department of Surgery, Asahikawa Medical University, Midorigaoka-Higashi 2-1-1-1 Asahikawa Hokkaido 078-8510, Japan Full list of author information is available at the end of the ... Tokusashi 2 , Naoyuki Miyokawa 2 , Tadahiro Sasajima 1 Abstract Adenoid cystic carcinoma of the peripheral lung is a rare entity. We recently encountered a patient...

Ngày tải lên: 09/08/2014, 03:22

... macrocystic transformation resembling ovarian muci- nous cystadenocarcinoma in a case of synchronous bilateral infiltrating ductal carcinoma. Pathol Int 2008, 58(9):601-5. 48. Morinaga S, Ohyama R, Koizumi ... PP and IP collected case details and helped in the literature search and drafting of the manuscript. All authors read and approved the final man- uscript. Appendix...

Ngày tải lên: 09/08/2014, 04:21

... upstream of furS) IEcorev CGAGAATTCGAAAACGAACGGTGC (located upstream of furS and ending at the 5¢-end of binding site I) B IEcofor GTTGAATTCTCGTGTTTATGAGGG (located upstream of furS and beginning at ... (5¢-CGACGACACCGGCACC GA-3¢) and S2c (5¢-CGGGGCCAGGACGACGAGCA-3¢). Each of the fragments was end-labeled with [ 32 P]ATP[cP] using T4 polynucleotide kinase. An aliquot of the...

Ngày tải lên: 07/03/2014, 10:20

... functional catalytic triad made of a catalytic nucleophile serine, associated to a proton c arrier histidine and a c harge r elaying aspartic (or glutamic) acid. To further investigate the biochemical ... (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. 12. Vincentelli, R., Canaan, S., Campanacci, V., Valencia...

Ngày tải lên: 07/03/2014, 16:20

... hydrogenase was substantially decreased in the DhupC (HCMG4) strain. At the same time, the in vitro activity was twice as high as that of the strain harbouring HupC (Table 5). A comparison of the hupSL ... USA) [34]. The plates were incubated in anaerobic jars by means of the AnaeroCult (Merck, Darmstadt, Germany) system for 2 weeks. The E. coli strains were main...

Ngày tải lên: 16/03/2014, 03:20

... resulting in the loss of a UBL domain. Using these mutants and a wild-type NUB1, we then examined the interaction with UbC1 in yeast cells. In the assay, UbC1 fused to the Gal4 DNA-activation domain ... and/or an N-terminal deletion. For example, M1 had a C-terminal deletion from Lys371 to Asn601, resulting in the loss of two UBA domains (UBA1 and UBA3) and a PES...

Ngày tải lên: 23/03/2014, 12:20

... presentation of ESC carcinoma is usually at an advanced stage due to the aggressive nature of the disease. Therapeutic modalities are determined by the location and extent of disease. Chemotherapy remains the ... confirming a primary small cell carcinoma of her appendix. Conclusion: This is the first reported case of a pure extrapulmonary carcinoma arising from th...

Ngày tải lên: 09/08/2014, 07:21

... University of Milan, Fondazione Ospedale Maggiore Policlinico, Mangiagalli e Regina Elena, IRCCS, Milan, Italy and 4 A. O. San Paolo, U.O. Anatomia Patologica, Milan, Italy Email: Luigi Santambrogio ... course, the malignant form has also been reported. Case presentation: We herein describe a case of 72 year-old man with head, facial, and thoracic traumas caused by neurally-med...

Ngày tải lên: 09/08/2014, 07:21

... protein contains several impor- tant domains such as 1) the C-terminal protein kinase domain (PI3K-domain), 2) the substrate binding domain in the N-terminal of the protein necessary for activation ... Corresponding author Abstract Background: The ATM protein is activated as a result of ionizing radiation, and genetic variants of the ATM gene may therefore affect the...

Ngày tải lên: 09/08/2014, 10:21