báo cáo khoa học: " Radiological and pathological findings of a metastatic composite paraganglioma with neuroblastoma in a man: a case report" pptx

báo cáo khoa học: " Radiological and pathological findings of a metastatic composite paraganglioma with neuroblastoma in a man: a case report" pptx

báo cáo khoa học: " Radiological and pathological findings of a metastatic composite paraganglioma with neuroblastoma in a man: a case report" pptx

... article as: Fritzsche et al.: Radiological and pathological findings of a metastatic composite paraganglioma with neuroblastoma in a man: a case report. Journal of Medical Case Reports 2010 4:3 74. Submit ... contributions TF and SK analyzed the clinical and radiological data. FRF and PKB analyzed and interpreted the pathological data. TF and...
Ngày tải lên : 11/08/2014, 02:22
  • 5
  • 347
  • 0
Báo cáo khoa học: "Physiological and pathological aspects of long-term storage of acorns" potx

Báo cáo khoa học: "Physiological and pathological aspects of long-term storage of acorns" potx

... content of acorns and the exploitation of starch reserves at germination decreased with increasing duration of storage. Ageing processes are prob- ably impairing the availability ... laboratory frost-hardiness test were run for about 20 days at specific temperatures. The great variability within the acorn popula- tion contrasted with a varianc...
Ngày tải lên : 08/08/2014, 19:21
  • 4
  • 166
  • 0
Báo cáo khoa học: Cloning and functional characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis doc

Báo cáo khoa học: Cloning and functional characterization of Phaeodactylum tricornutum front-end desaturases involved in eicosapentaenoic acid biosynthesis doc

... desaturases from M. alpina,whereasinthecaseof C. elegans or man, each pair of front-end desaturases formed a separate branch (data not shown). This may indi- cate that the D5- and D6-desaturases from P. ... gel separation, DNA molecules larger than 300 bp were ligated into vector arms and packaged into lambda ZAP Express phages using the Gigapack Gold Kit (Stratagene, Amsterdam, Nethe...
Ngày tải lên : 31/03/2014, 09:20
  • 9
  • 455
  • 0
Báo cáo khoa học: "Prevalence and associated factors of physical fighting among school-going adolescents in Namibia" pptx

Báo cáo khoa học: "Prevalence and associated factors of physical fighting among school-going adolescents in Namibia" pptx

... while a response of ≥1 was classified as having engaged in a phys- ical fight. Data analysis was performed using SUDAAN software (Research Triangle Institute, Durham, NC, USA, version 9.0). A weighting ... estimate may also allow cross- country comparisons regarding the prevalence of health behaviours and associated factors. Methods Our study involved secondary analysis of exi...
Ngày tải lên : 08/08/2014, 23:20
  • 5
  • 315
  • 0
báo cáo khoa học: " Psychosocial and contextual correlates of opioid overdose risk among drug users in St. Petersburg, Russia" pot

báo cáo khoa học: " Psychosocial and contextual correlates of opioid overdose risk among drug users in St. Petersburg, Russia" pot

... overdoses and arrived in a median of 20 minutes (range 5 – 60). Naloxone was administered in five cases (22.7%), two of which did not involve a request for an ambulance. Variables associated with having ... the final manuscript. Acknowledgements Funding for this study was provided by NIH/Fogarty International Center as part of the International Clinical Operational and He...
Ngày tải lên : 11/08/2014, 18:20
  • 11
  • 328
  • 0
báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

... University of Alabama at Birmingham, Birmingham, Alabama, USA and 5 Vinnitsya National Medical University – Pirogov, Vinnitsya, Ukraine Email: Kostyantyn V Dumchev - k.dumchev@gmail.com; Ruslan Soldyshev ... study and participated in design, data collection, statistical analyses, and interpretation of results and led drafting of the manuscript. JS participated in study des...
Ngày tải lên : 11/08/2014, 18:20
  • 9
  • 331
  • 0
Báo cáo khoa học: "Lameness and Claw Lesions of the Norwegian Red Dairy Cattle Housed in Free Stalls in Relation to Environment, Parity and Stage of Lactation" pps

Báo cáo khoa học: "Lameness and Claw Lesions of the Norwegian Red Dairy Cattle Housed in Free Stalls in Relation to Environment, Parity and Stage of Lactation" pps

... Corkscrewed lateral hind claws included both mild cases where the abaxial wall was bent inwards with a curved dorsal border and serious cases of corkscrew claws where the abaxial wall was part of the ... Effects of conformation and manage- ment system on hoof and leg diseases and lame- ness in dairy cows. In: Veterinary Clinics of North America: Food Animal Practice (ed...
Ngày tải lên : 12/08/2014, 15:21
  • 15
  • 295
  • 0
Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

Tài liệu Báo cáo khoa học: Functional and structural analyses of N-acylsulfonamidelinked dinucleoside inhibitors of RNase A ppt

... nucleic acid-binding proteins. Database Structural data for the two RNase A complexes are available in the Protein Data Bank under accession numbers 2xog and 2xoi Abbreviations PDB, Protein Data Bank; ... & Mazzarella L (1998) Binding of a substrate analog to a domain swapping protein: X-ray structure of the com- plex of bovine seminal ribonuclease with uridylyl-(2¢,5¢)-...
Ngày tải lên : 14/02/2014, 22:20
  • 9
  • 626
  • 0
Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

Tài liệu Báo cáo khoa học: Active and regulatory sites of cytosolic 5¢-nucleotidase doc

... TTAAATCCATGTGCACAG R144E AGAAGATGACACTGAAAG TGAATAAATTTATTTGGATAC I152D CGATCTGAACACACTATTC TAAAATCTTTCAGTGTCAT N154D GGACACACTATTCAACCT AGAATGTAAAATCTTTCAGT K31 1A CGCGCTGAAAATTGGTAC CCAGTTTTAGTATCCACC G319D ... AGTGTTTTGGGTTTGACATGGATGGCACACTTGCTG CAGCAAGTGTGCCATCCATGTCAAACCCAAAACACT T56V AGTGTTTTGGGTTTGACATGGATTATGTGCTTGCTG CAGCAAGCACATAATCCATGTCAAACCCAAAACACT Regulation of cytosolic 5¢...
Ngày tải lên : 15/02/2014, 01:20
  • 10
  • 563
  • 0

Xem thêm