báo cáo khoa học: "Vulval elephantiasis as a result of tubercular lymphadenitis: two case reports and a review of the literature" pptx

... Access Vulval elephantiasis as a result of tubercular lymphadenitis: two case reports and a review of the literature Chintamani 1* , JP Singh 1 , Megha Tandon 1 , Rohan Khandelwal 1 , Tushar Aeron 1 , ... cases of filarial elephantiasis [7]. Elephantiasis of the female genitalia due to other causes is rarer still. We present two unusual cases of vul...

Ngày tải lên: 11/08/2014, 02:22

... incisor proclina- tion and maintenance of lower facial height (Figure 20, 21 and Table 2). Alternative treatment plan Surgically assisted rapid palatal expansion (SARPE) and slow palatal expansion (SPE) ... Arabia (KSA) ATG is an associate professor and consultant of periodontics at KAU. He is the chairman of Oral Basic and Clinical Sciences Department, and the chairman...

Ngày tải lên: 11/08/2014, 20:20

... other hand, Shung et al in a series of 63 cases [59], De Perrot et al in a series of 15 cases [60], and Perna et al with 8 cases [61], did not report a single case of hypoglycemia. As already mentioned, ... making the pathological diagnosis. MW and TH were involved in the case report, clinical workup and management of the patient. AK and JM did the literatu...

Ngày tải lên: 10/08/2014, 10:20

... mutant of the variant at both pH 7 and pH 5. Each panel is a plot of heat change on ligand addition (kcalÆmole )1 ) against the ligand ⁄ stefin molar ratio for one of the proteins analysed. The ... generated or absorbed as the ligand-macromolecule reaction occured. A binding isotherm was fitted to the data, expressed in terms of the heat change per mole of ligand...

Ngày tải lên: 19/02/2014, 06:20

... immunohistochemical staining feature of benign schwannomas, the variants with malignant degeneration lesion may vary. The diagnos is of malig- nant peripheral nerve sheath tumor lacks standardized diagnostic ... into various phenotypes. This theory can also explain the different types of elements found in the schwannoma [8,9]. Malignant schwannomas are aggressive tumors that act...

Ngày tải lên: 09/08/2014, 03:22

... 4:46 http://www.jmedicalcasereports.com/content/4/1/46 Page 2 of 4 CAS E REP O R T Open Access Unusual presentation of eosinophilic fasciitis: two case reports and a review of the literature Ramazan Danis 1 , Sami ... images. Danis et al. Journal of Medical Case Reports 2010, 4:46 http://www.jmedicalcasereports.com/content/4/1/46 Page 3 of 4 chest radiography, esop...

Ngày tải lên: 11/08/2014, 14:21

... MINIREVIEW Pharmacologic chaperoning as a strategy to treat Gaucher disease Zhanqian Yu, Anu R. Sawkar and Jeffery W. Kelly Department of Chemistry and The Skaggs Institute for Chemical Biology, ... partially active GC vari- ants, as demonstrated by increased cellular GC activity, an increased concentration of lysosomal GC glyco- forms and increased colocalization of GC wi...

Ngày tải lên: 18/02/2014, 16:20

... library in half and sort one half against a binding partner and the other half against an expression tag. A comparison of the sequences obtained from these two different selections should reveal ... protein stability, the affinities of purified mutant proteins for target can be measured by standard methods (immunoassay or surface plasmon resonance) at the temperature of...

Ngày tải lên: 19/02/2014, 12:20

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk. The resulting PCR prod- ucts, containing ... (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified. The...

Ngày tải lên: 19/02/2014, 17:20

... through an example. Finally, we assess the practical efficiency of our approach and discuss future work in Section 4. 2 Grammaticality as planning We start by reviewing the LTAG grammar formal- ism and ... the atoms subst(S, 1.self) and step(1) and a final state consisting of the following goal: A, u.¬subst (A, u) ∧ A, u.¬mustadjoin (A, u). We can then send the action...

Ngày tải lên: 20/02/2014, 12:20