báo cáo khoa học: " Thoracoscopic-assisted repair of a bochdalek hernia in an adult: a case report" pptx

Báo cáo khoa học: " Surgical management of mediastinal liposarcoma extending from hypopharynx to carina: Case report" pptx

Báo cáo khoa học: " Surgical management of mediastinal liposarcoma extending from hypopharynx to carina: Case report" pptx

... tomography (CT) scans of the neck and chest revealed a large mass extending from the hypopharynx to the carina (Figures 1 &2), causing sig nifi cant displacement of the larynx, trachea, and ... mediastinal liposarcoma despite often daunting preoperative imaging [1,3]. In this case we repo rt on the surgical resection of a large primary med- iastinal liposarcoma by sternotomy...
Ngày tải lên : 09/08/2014, 03:21
  • 2
  • 319
  • 0
báo cáo khoa học: " Thoracoscopic-assisted repair of a bochdalek hernia in an adult: a case report" pptx

báo cáo khoa học: " Thoracoscopic-assisted repair of a bochdalek hernia in an adult: a case report" pptx

... Carmona R, Salas M: Thoracoscopic and laparoscopic repair of complicated Bochdalek hernia in adult. Hernia 2008, 12:307-309. 10. Kocakusak A, Arikan S, Senturk O, Yucel AF: Bochdalek s hernia in an ... this article as: Tokumoto et al.: Thoracoscopic-assisted repair of a bochdalek hernia in an adult: a case report. Journal of Medical Case Reports 2...
Ngày tải lên : 11/08/2014, 02:22
  • 5
  • 241
  • 0
Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx

Báo cáo khoa học: New members of the brachyurins family in lobster include a trypsin-like enzyme with amino acid substitutions in the substrate-binding pocket potx

... higher than in PaTry1 and PaTry2, and 2.8 times higher than in PaTry3. Among crustacean trypsins in Fig. 5, such a high con- tent of Arg was only observed in Homarus americanus. The rest of P. argus ... different organs was purified as described above and additionally Table 3. Amino acid sequences of trypsinogen signal and activation peptides of Panulirus argus and some other...
Ngày tải lên : 23/03/2014, 03:20
  • 13
  • 474
  • 0
báo cáo khoa học: "Microspatial differentiation of Drosophila melanogaster populations in and around a wine cellar in southern Spain Angeles ALONSO-MORAGA" pdf

báo cáo khoa học: "Microspatial differentiation of Drosophila melanogaster populations in and around a wine cellar in southern Spain Angeles ALONSO-MORAGA" pdf

... within and outside an Australian wine cellar. In France, natural populations are characterized by a very stable genetic structure at the Adh locus since the frequency of ... Drosophila melanogaster. Genet. Res., 36, 11-15. Microspatial differentiation of Drosophila melanogaster populations in and around a wine cellar in southern Spain Angel...
Ngày tải lên : 09/08/2014, 22:22
  • 8
  • 216
  • 0
Báo cáo khoa học: Microarray analyses of hypoxia-regulated genes in an aryl hydrocarbon receptor nuclear translocator (Arnt)-dependent manner ppt

Báo cáo khoa học: Microarray analyses of hypoxia-regulated genes in an aryl hydrocarbon receptor nuclear translocator (Arnt)-dependent manner ppt

... Fernandez-Salas E, Yu M, Hussain A, Dinman JD, Peltz SW, Huang Y & Fornace AJ Jr (1999) Cloning and characterization of a human geno- toxic and endoplasmic reticulum stress-inducible cDNA that ... for shRNA against mouse HIF- 1a (GenBank accession number AF003695) was 5¢-GATCCGTGTGAGCTCACATCTTGATTTCAAGAG AATCAAGATGTGA GCTCA CAT TTTTTA GATCT G-3¢. The sequence for control shRNA was...
Ngày tải lên : 23/03/2014, 06:20
  • 17
  • 264
  • 0
báo cáo khoa học: "Malignant peripheral nerve sheath tumor arising from the greater omentum: Case report" pptx

báo cáo khoa học: "Malignant peripheral nerve sheath tumor arising from the greater omentum: Case report" pptx

... T, Takahashi A, Asakawa H, Uehara A, Kohogo Y, Suzuki T: Malignant intestinal schwannoma: a case report and a review of the literature in Japan. Intern Med 1995, 34:1101-1105. 7. Telem DA, Pertsemlidis ... arising from the greater omentum: Case report Masashi Miguchi, Yuji Takakura * , Hiroyuki Egi, Takao Hinoi, Tomohiro Adachi, Yasuo Kawaguchi, Manabu Shinomura, Masakazu Tokuna...
Ngày tải lên : 09/08/2014, 01:24
  • 4
  • 394
  • 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 10482 10661 179 1G4P217 Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTA...
Ngày tải lên : 14/02/2014, 19:20
  • 12
  • 795
  • 0
Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

Tài liệu Báo cáo khoa học: The role of the ESSS protein in the assembly of a functional and stable mammalian mitochondrial complex I (NADH-ubiquinone oxidoreductase) pptx

... from Covance BabCo, anti-mouse and anti-rabbit secondary antibodies from Bio-Rad Laboratories and Amersham Pharmacia Biotech, respectively. Antibodies against the Rieske protein, PSST, and 18 kDa were ... utants with a proposed X-linkage. Sequence analyses of the ESSS cDNA in these mutants revealed chain termination mutations. In two of these mutants the protein i s truncated at the...
Ngày tải lên : 19/02/2014, 16:20
  • 9
  • 622
  • 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

... Japan; 2 Institute for Protein Research, Osaka University, Suita, Osaka, Japan; 3 School of Knowledge Science, Japan Advanced Institute of Science and Technology, Ishikawa, Japan Achromobacter ... Shiraki, School of Materials Science, Japan Advanced Institute of Science and Technology, 1-1 Asahidai, Tatsunokuchi, Ishikawa, 923-1292, Japan. E-mail: kshiraki@jaist.ac.jp Abbreviations:AP...
Ngày tải lên : 21/02/2014, 03:20
  • 7
  • 603
  • 0
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt

... dehydro- genase electron transfer chain. Adv Inorg Chem 45, 351–407. 3 Lommen A, Ratsma A, Bijlsma N, Canters GW, Van Wielink JE, Frank J & Van Beeumen J (1990) Isola- tion and characterization of ... does not result in a ligand-exchange mechanism at alkaline pH for the M100K variant which contrasts to what occurs in the presence of the chemical denaturant GdmHCl as ascertaine...
Ngày tải lên : 07/03/2014, 17:20
  • 15
  • 509
  • 0

Xem thêm

Từ khóa: