báo cáo khoa học: " Eosinophilic infiltrate in a patient with severe Legionella pneumonia as a levofloxacin-related complication: a case report" potx

báo cáo khoa học: " Eosinophilic infiltrate in a patient with severe Legionella pneumonia as a levofloxacin-related complication: a case report" potx

báo cáo khoa học: " Eosinophilic infiltrate in a patient with severe Legionella pneumonia as a levofloxacin-related complication: a case report" potx

... 2003, 21:489-494. doi:10.1186/1752-1947-4-360 Cite this article as: Facciolongo et al.: Eosinophilic infiltrate in a patient with severe Legionella pneumonia as a levofloxacin-related complication: a case report. Journal of Medical Case Reports ... the clinical approach, analyzed and interpreted the data and was a major contributor in writing the manuscrip...

Ngày tải lên: 11/08/2014, 02:22

5 269 0
Báo cáo khoa học: "Eosinophilic myositis in a slaughtered Korean native cattle" pps

Báo cáo khoa học: "Eosinophilic myositis in a slaughtered Korean native cattle" pps

... Korea Histopathological findings of eosinophilic myositis in the carcass of a slaughtered Korean native cow are presented. Lesions contained massive fibrous septae with vacuolar changes in some ... describe a case of EM in a 3-year-old cow with a normal history and no pre-existing clinical conditions at the time of slaughter. A routine postmortem inspection of th...

Ngày tải lên: 07/08/2014, 23:22

3 180 0
Báo cáo khoa học: Collective behavior in gene regulation: The cell is an oscillator, the cell cycle a developmental process doc

Báo cáo khoa học: Collective behavior in gene regulation: The cell is an oscillator, the cell cycle a developmental process doc

... replicating and dividing with the minimal genera- tion times. Kinetically, the yeast stochastic tissue and a mammalian tissue such as the epithelial cells of the gastro-intestinal tract are similar ... realization has opened a new and experimentally more accessible path to investigations of synchronous gating and the role of oscillations in generating and maintaining a stable phen...

Ngày tải lên: 30/03/2014, 04:20

13 238 0
báo cáo khoa học: "Precocious puberty in an infant with hepatoblastoma: a case report" doc

báo cáo khoa học: "Precocious puberty in an infant with hepatoblastoma: a case report" doc

... puberty in a boy with HcG-producing hepatoma. Case report. Helv Paediatr Acta 1980, 35(2):155-163. 11. Morinaga S, Yamaguchi M, Watanabe I, Kasai M, Ojima M, Sasano N: An immunohistochemical study ... 5:422 http://www.jmedicalcasereports.com/content/5/1/422 Page 2 of 4 CASE REP O R T Open Access Precocious puberty in an infant with hepatoblastoma: a case report Usama Al-Juma...

Ngày tải lên: 10/08/2014, 23:20

4 378 0
Báo cáo khoa học: "Anaphor resolution in unrestricted texts with partial parsing" doc

Báo cáo khoa học: "Anaphor resolution in unrestricted texts with partial parsing" doc

... texts with partial parsing A. Ferr~indez; M. Palomar Dept. Languages and Information Systems Alicante University - Apt. 99 03080 - Alicante - Spain antonio@dlsi.ua.es mpalomar@dlsi.ua.es ... measures because we have worked on different texts (Spanish texts). apply a partial parsing and we deal with other kinds of anaphors. As a future aim we will include semantic informatio...

Ngày tải lên: 08/03/2014, 05:21

7 274 0
Báo cáo khoa học: Leadzyme formed in vivo interferes with tobacco mosaic virus infection in Nicotiana tabacum potx

Báo cáo khoa học: Leadzyme formed in vivo interferes with tobacco mosaic virus infection in Nicotiana tabacum potx

... 5¢-TA ATACGACTCACTATAGGGCGAATAGGCGGGAATT TTGCATC-3¢ containing the T7 polymerase promoter sequence, and TMV4 (downstream) 5¢-CAATACTGT CTTTCTGGCCTTC-3¢. TMV RNA was transcribed in vitro using ... genome within the replicase-coding sequence (ORF 1) was an additional advantage. The designed catalytic strand of the leadzyme was a 16-nucleotide RNA (5¢-ACAUAUGGAGUCCCUU-3¢), and its binding to...

Ngày tải lên: 16/03/2014, 12:20

10 401 0
Báo cáo khoa học: "Correcting errors in speech recognition with articulatory dynamics" pot

Báo cáo khoa học: "Correcting errors in speech recognition with articulatory dynamics" pot

... training and 10% testing sets for 5-cross validation. MOCHA and TORGO data are never combined in a single training set due to dif- fering EMA recording rates. In all cases, models are database-dependent ... of increased inter-speaker articulatory varia- tion in the TORGO database, which includes more than twice as many speakers as MOCHA. Figure 7 shows the WER obtained with TD-...

Ngày tải lên: 16/03/2014, 23:20

9 322 0
Báo cáo khoa học: "CAPTURING LINGUISTIC IN ANANNOTATED GENERALIZATIONS WITH METARULES PHRASE-STRUCTURE GRAMMAR" ppt

Báo cáo khoa học: "CAPTURING LINGUISTIC IN ANANNOTATED GENERALIZATIONS WITH METARULES PHRASE-STRUCTURE GRAMMAR" ppt

... the grammar. Each feature has a name (a string of uppercase alphanumeric characters) and an associated value. The values a feature can take on (the domain of the feature) are, in general, arbitrary. ... features whose domain is a phrase marker. Since phrase markers are just data structures that the parser creates, they can be assigned as the value of a feature. This techniq...

Ngày tải lên: 24/03/2014, 01:21

6 297 0
Báo cáo khoa học: " Audiological findings in patients treated with radio- and concomitant chemotherapy for head and neck tumors" potx

Báo cáo khoa học: " Audiological findings in patients treated with radio- and concomitant chemotherapy for head and neck tumors" potx

... show association with decreased hearing, according to Fisher exact test statistical analysis. The only factors associated to this decreased hearing, according to the ASHA criteria were the age ... Decreased hearing after combined modality therapy for head and neck cancer. Am J Otolaryngol 2006, 27(2):76-80. 2. American Speech-Language-Hearing Association (ASHA): Guide- lines for the audiolo...

Ngày tải lên: 09/08/2014, 10:20

7 371 0
Từ khóa:
w