báo cáo khoa học: " Eosinophilic infiltrate in a patient with severe Legionella pneumonia as a levofloxacin-related complication: a case report" potx
báo cáo khoa học: " Eosinophilic infiltrate in a patient with severe Legionella pneumonia as a levofloxacin-related complication: a case report" potx
... 2003,
21:489-494.
doi:10.1186/1752-1947-4-360
Cite this article as: Facciolongo et al.: Eosinophilic infiltrate in a patient
with severe Legionella pneumonia as a levofloxacin-related
complication: a case report. Journal of Medical Case Reports ... the
clinical approach, analyzed and interpreted the data and was a major
contributor in writing the manuscrip...
Báo cáo khoa học: "Eosinophilic myositis in a slaughtered Korean native cattle" pps
... Korea
Histopathological findings of eosinophilic myositis in the
carcass of a slaughtered Korean native cow are presented.
Lesions contained massive fibrous septae with vacuolar
changes in some ... describe a case of EM in a 3-year-old cow
with a normal history and no pre-existing clinical
conditions at the time of slaughter. A routine postmortem
inspection of th...
Báo cáo khoa học: Collective behavior in gene regulation: The cell is an oscillator, the cell cycle a developmental process doc
... replicating and dividing with the minimal genera-
tion times. Kinetically, the yeast stochastic tissue and a
mammalian tissue such as the epithelial cells of the
gastro-intestinal tract are similar ... realization has opened
a new and experimentally more accessible path to
investigations of synchronous gating and the role
of oscillations in generating and maintaining a stable
phen...
báo cáo khoa học: "Precocious puberty in an infant with hepatoblastoma: a case report" doc
... puberty in a boy
with HcG-producing hepatoma. Case report. Helv Paediatr Acta 1980,
35(2):155-163.
11. Morinaga S, Yamaguchi M, Watanabe I, Kasai M, Ojima M, Sasano N: An
immunohistochemical study ... 5:422
http://www.jmedicalcasereports.com/content/5/1/422
Page 2 of 4
CASE REP O R T Open Access
Precocious puberty in an infant with
hepatoblastoma: a case report
Usama Al-Juma...
Báo cáo khoa học: "Anaphor resolution in unrestricted texts with partial parsing" doc
... texts with partial parsing
A. Ferr~indez; M. Palomar
Dept. Languages and Information Systems
Alicante University - Apt. 99
03080 - Alicante - Spain
antonio@dlsi.ua.es mpalomar@dlsi.ua.es ... measures because
we have worked on different texts (Spanish texts).
apply a partial parsing and we deal with other
kinds of anaphors.
As a future aim we will include semantic
informatio...
Báo cáo khoa học: Leadzyme formed in vivo interferes with tobacco mosaic virus infection in Nicotiana tabacum potx
... 5¢-TA
ATACGACTCACTATAGGGCGAATAGGCGGGAATT
TTGCATC-3¢ containing the T7 polymerase promoter
sequence, and TMV4 (downstream) 5¢-CAATACTGT
CTTTCTGGCCTTC-3¢. TMV RNA was transcribed
in vitro using ... genome within the replicase-coding sequence
(ORF 1) was an additional advantage. The designed
catalytic strand of the leadzyme was a 16-nucleotide
RNA (5¢-ACAUAUGGAGUCCCUU-3¢), and its
binding to...
Báo cáo khoa học: "Correcting errors in speech recognition with articulatory dynamics" pot
... training and 10% testing sets for
5-cross validation. MOCHA and TORGO data are
never combined in a single training set due to dif-
fering EMA recording rates. In all cases, models
are database-dependent ... of increased inter-speaker articulatory varia-
tion in the TORGO database, which includes more
than twice as many speakers as MOCHA.
Figure 7 shows the WER obtained with TD-...
Báo cáo khoa học: "CAPTURING LINGUISTIC IN ANANNOTATED GENERALIZATIONS WITH METARULES PHRASE-STRUCTURE GRAMMAR" ppt
... the grammar.
Each feature has a name (a string of uppercase alphanumeric
characters) and an associated value. The values a feature can
take on (the domain of the feature) are, in general, arbitrary. ... features whose domain is a phrase
marker. Since phrase markers are just data structures that the
parser creates, they can be assigned as the value of a feature.
This techniq...
Báo cáo khoa học: " Audiological findings in patients treated with radio- and concomitant chemotherapy for head and neck tumors" potx
... show association with decreased
hearing, according to Fisher exact test statistical analysis.
The only factors associated to this decreased hearing,
according to the ASHA criteria were the age ... Decreased hearing
after combined modality therapy for head and neck cancer.
Am J Otolaryngol 2006, 27(2):76-80.
2. American Speech-Language-Hearing Association (ASHA): Guide-
lines for the audiolo...
Từ khóa: