báo cáo khoa học: "Acute hepatocellular and cholestatic injury during therapy with hydrochlorothiazide clinicohistopathologic findings: a case report" potx

... resistance and causes visceral and hepatic fat accumulation. Hypertension 2008, 52:1030. 12. Kaihara M, Nakamura Y, Sugimoto T, Uchida HA, Norii H, Hanajama Y, Makino H: Olmesartan and tenocapril ... as: Taglietti et al.: Acute hepatocellular and cholestatic injury during therapy with hydrochlorothiazide - clinicohistopathologic findings: a case report. Journal o...

Ngày tải lên: 11/08/2014, 02:21

... obstruction after blunt abdominal trauma. A case report. Acta Chir Belg 2008, 108(5):597-599. 7. Maharaj D, Perry A, Ramdass M, Naraynsingh V: Late small bowel o bstruction after blunt abdominal trauma. ... Holevar M, Nagy KK, Patterson L, Young JS, Arrillaga A, Najarian MP, Valenziano CP, Eastern Association for the Surgery of Trauma: Practice management guidelines for the evaluation...

Ngày tải lên: 10/08/2014, 23:20

... 5:512 http://www.jmedicalcasereports.com/content/5/1/512 Page 3 of 4 CAS E REP O R T Open Access Delay in diagnosis of generalized miliary tuberculosis with osseo-articular involvement: a case report Chaturaka Rodrigo * and Inoshi Atukorala Abstract Introduction: ... Karahan M: Tuberculosis of the knee joint: a case report. Acta Orthop Traumatol Turc 2008, 42:214-218. Rodrigo and...

Ngày tải lên: 10/08/2014, 23:20

... local excision of a seminal vesicle to pelvic exen- teration. As an adjuvant treatment, radiotherapy, che- motherapy and hormonal manipulation are debated. Case presentation A 70-year-old Caucasian ... 4:320 http://www.jmedicalcasereports.com/content/4/1/320 Page 4 of 4 scan of the cranium, thorax and abdomen, and a trans- rectal ultrasound. The suspicious, enlarged para-aortal...

Ngày tải lên: 11/08/2014, 02:21

... Psychiatry 1971, 34, 415-426. 15. Iwane M, Kitamura Y, Kaisho Y, Yoshimura K, Shintani A, Sasada R, Nakagawa S, Kawahara K, Nakahama K, Kakinuma A. Production, purification and characterization ... DNA was synthesized artificially based on the sequence of the predicted Canis familiaris nerve growth factor beta (5′-ATGTCCATGTTGTTCTACACTCTGAT CACAGCTCTTCTGATCGGCATCCGGGCAGAACC GCATCCAGA...

Ngày tải lên: 07/08/2014, 23:22

Ngày tải lên: 10/08/2014, 23:20

... case with an unusual presentation simulating a testicular neoplasm. Case presentation A 25-year-old Caucasian m an went to a general practi- tioner because of right testicular swelling and was ... testicle was enlarged and painful on palpation, and the skin of the right hemiscrotal region was red and warm. Pain increased gradually and worsened slightly with time, but t...

Ngày tải lên: 09/08/2014, 01:25

... City, Kanagawa, 235-0045, Japan. 2 Department of Radiology, Saiseikai Yokohama- shi Nanbu Hospital, 3-2-10, Konandai, Konan-ku, Yokohama City, Kanagawa, 234-8503, Japan. 3 Department of Pathology, ... Kurumaya H, Katayanagi K, Masuda S, Niwa H, Morimoto H, Miwa A, Uchiyama A, Portmann BC, Nakanuma Y: IgG4-related sclerosing cholangitis with and without hepatic inflammatory pseudotumor,...

Ngày tải lên: 10/08/2014, 23:20

... in pregnancy managed successfully by liver transplantation: A case report. Journal of Medical Case Reports 2011 5:461. Submit your next manuscript to BioMed Central and take full advantage of: ... Fulminant hepatic failure associated with propylthiouracil. Ann Pharmacother 2003, 37:224-228. 11. Russo MW, Galanko JA, Shrestha R, Fried MW, Watkins P: Liver transplantation for acute li...

Ngày tải lên: 10/08/2014, 23:20

... D, Bansal A, Saxena S: Carcinoma developing in a fibroadenoma in a woman with a family history of breast cancer: a case report and review of literature. Cases Journal 2009, 2:9348. 7. Vargas-Roig ... methylation and protein expression in breast fibroadenoma and carcinoma. Int J Cancer 2005, 114:414-421. 6. Chintamani , Khandelwal R, Tandon M, Yashwant K, Kulshresthal P, Aer...

Ngày tải lên: 10/08/2014, 23:20