báo cáo khoa học: " Endovascular covered stenting for the management of post-percutaneous nephrolithotomy renal pseudoaneurysm: a case report" doc

báo cáo khoa học: " Endovascular covered stenting for the management of post-percutaneous nephrolithotomy renal pseudoaneurysm: a case report" doc

báo cáo khoa học: " Endovascular covered stenting for the management of post-percutaneous nephrolithotomy renal pseudoaneurysm: a case report" doc

... to achieve endovascular exclusion of the PA. A control angiogram at the end of the procedure revealed the absence of opa- cification of the PA, with the appropriate preservation of renal parenchymal ... result of the endovascular manipulation. Uniform global enhancement of the renal parenchyma was noted. There were no signs of active contrast extra- v...

Ngày tải lên: 11/08/2014, 02:21

4 321 0
báo cáo khoa học: "Emergency adrenalectomy due to acute heart failure secondary to complicated pheochromocytoma: a case report" docx

báo cáo khoa học: "Emergency adrenalectomy due to acute heart failure secondary to complicated pheochromocytoma: a case report" docx

... he patient was transferred to the ward, where oral tolerance therapy was started. He was then placed in the care of the Endo- crinology Unit, for subsequent observation (table 2) and management. Disscusion Although ... clinical presentation is hypertension, mainly in the form of paroxymal episodes. Cardiovascular manifestations include malignant arrhythmia and catecholamine ca...

Ngày tải lên: 09/08/2014, 01:24

5 346 0
Báo cáo y học: "Double Shunt technique for hybrid palliation of hypoplastic left heart syndrome : a case report" pot

Báo cáo y học: "Double Shunt technique for hybrid palliation of hypoplastic left heart syndrome : a case report" pot

... and VOC participated in the manuscript writing. MBJ was the chief surgeon and responsible for finalization of the manuscript. All authors have read and approved the final manuscript. Acknowledgements: ... reported an alternative solution to palliate HLHS, with pulmonary artery (PA) to innominate artery shunt, associated to bilateral pulmonary artery banding (PAB), patent duc...

Ngày tải lên: 10/08/2014, 09:22

13 331 0
Báo cáo y học: "Split tendon transfers for the correction of spastic varus foot deformity: a case series study" ppsx

Báo cáo y học: "Split tendon transfers for the correction of spastic varus foot deformity: a case series study" ppsx

... walking, the range of motion of the foot and ankle, callus formation and the foot appearance using the clinical criteria of Hoffer et al [1] in Group I andofKlingetal[6]inGroupII.AccordingtoHoffer [1], ... junction. The medial half of the tendon was left attached to the first metatarsal and first cunei- form, but the lateral half was detached from its insertion. The...

Ngày tải lên: 10/08/2014, 21:24

11 448 0
báo cáo khoa học: " Suspected idiopathic sclerosing orbital inflammation presenting as immunoglobulin G4-related disease: a case report" doc

báo cáo khoa học: " Suspected idiopathic sclerosing orbital inflammation presenting as immunoglobulin G4-related disease: a case report" doc

... Clinic, 1-7-25, Yokodai, Isogo-ku, Yokohama City, Kanagawa, 235-0045, Japan Full list of author information is available at the end of the article Nagai et al. Journal of Medical Case Reports 2011, ... City, Kanagawa, 235-0045, Japan. 2 Department of Radiology, Saiseikai Yokohama- shi Nanbu Hospital, 3-2-10, Konandai, Konan-ku, Yokohama City, Kanagawa, 234-8503, Japan. 3 Departm...

Ngày tải lên: 10/08/2014, 23:20

5 313 0
Báo cáo khoa hoc:" Marathon related death due to brainstem herniation in rehydration-related hyponatraemia: a case report" docx

Báo cáo khoa hoc:" Marathon related death due to brainstem herniation in rehydration-related hyponatraemia: a case report" docx

... high-profile marathons worldwide). The development of symptoms in acute hyponatraemia depends on the rate of fall of serum Na rather than the absolute degree of hyponatraemia [3]. The osmotic gradient ... of hyponatraemia is increased. The level of hyponatraemia in the present case was relatively mild (130 mM) com- pared to other reported cases of hyponatraemic enc...

Ngày tải lên: 11/08/2014, 10:22

7 281 0
Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx

Tài liệu Báo cáo khoa học: Pathways and products for the metabolism of vitamin D3 by cytochrome P450scc docx

... provides a clear explanation for the inability of P450scc to cleave the side chain of vitamin D3. Hydroxylation of the side chain of cholesterol at the adjacent carbons C22 and C20, to produce 2 0a, 22R-dihydroxycholesterol ... synthesis by the human placenta. Placenta 26, 273–281. 2 Guryev O, Carvalho RA, Usanov S, Gilep A & Esta- brook RW (2003) A pathway for...

Ngày tải lên: 18/02/2014, 17:20

12 705 0
Tài liệu Báo cáo khoa học: "Incorporating Context Information for the Extraction of Terms" pdf

Tài liệu Báo cáo khoa học: "Incorporating Context Information for the Extraction of Terms" pdf

... of the European Chapter of the Asso- ciation for Computational Linguistics, EACL-94, pages 34-40. B~atrice Daille, I~ric Gaussier and Jean-Marc Lang,. 1994. Towards Automatic Extraction of ... used for the evaluation of the candidate string, and the amount of information that various context carries. We said that for this prototype we considered the adjective...

Ngày tải lên: 22/02/2014, 03:20

3 370 0
Báo cáo khoa học: YidC is required for the assembly of the MscL homopentameric pore potx

Báo cáo khoa học: YidC is required for the assembly of the MscL homopentameric pore potx

... was amplified from E. coli K12 genomic DNA, includ- ing a C-terminal HA tag, using primers 5¢-GCGCGCGA ATTCATGAGCATTATTAAAGAATTTCG-3¢ (forward) and 5¢-CGCGCGGGATCCTTAAGCATAATCAGGAAC ATCATAAGGATAACCACCAGGAGAGCGGTTATTC TGCTCTTTC-3¢ ... were 5¢-AGCAGAATAA CTGCTCTCCTGGTG-3¢ (forward) and 5¢-CACCAGGAG AGCAGTTATTCTGCT-3¢ (reverse), and those for MscL F54C were 5¢-GGGATCGATTGCAAACAGTTTGC-3¢ (forw...

Ngày tải lên: 07/03/2014, 02:20

9 466 0
Báo cáo khoa học: "Multilingual Multiplatform Architecture for the development of Natural Language Voice Services" ppt

Báo cáo khoa học: "Multilingual Multiplatform Architecture for the development of Natural Language Voice Services" ppt

... conversation. As we allow a dynamic change of language during the progress of any dialogue, our architecture must deal with the dynamic activation and deactivation of these resources for a particular language. FIGURE]: ... multilingual SLDS and initially it is able to hold dialogues in Spanish, Catalan, as well as in Latin American Spanish. Moreover the user can change the...

Ngày tải lên: 24/03/2014, 03:20

4 349 0
w