báo cáo khoa học: "Elevated transaminases as a predictor of coma in a patient with anorexia nervosa: a case report and review of the literature" pot

báo cáo khoa học: "Elevated transaminases as a predictor of coma in a patient with anorexia nervosa: a case report and review of the literature" pot

báo cáo khoa học: "Elevated transaminases as a predictor of coma in a patient with anorexia nervosa: a case report and review of the literature" pot

... 4:307 http://www.jmedicalcasereports.com/content/4/1/307 Page 4 of 4 CAS E REP O R T Open Access Elevated transaminases as a predictor of coma in a patient with anorexia nervosa: a case report and review of the literature Shuhei Yoshida 1,2* , Masahiko ... of the liver was higher than that of the spleen in a patient with AN and elevate...

Ngày tải lên: 11/08/2014, 02:21

4 411 0
Báo cáo khoa học: Distinct but critical roles for integrin aIIbb3 in platelet lamellipodia formation on fibrinogen, collagen-related peptide and thrombin pot

Báo cáo khoa học: Distinct but critical roles for integrin aIIbb3 in platelet lamellipodia formation on fibrinogen, collagen-related peptide and thrombin pot

... pathways such as activation of the capping protein gelsolin [10] and myosin light chain kinase. Intracellular Ca 2+ was measured by loading with the calcium reporter dye Oregon Green-BAPTA 1-AM and monitoring ... distinct pattern of intracellular Ca 2+ signalling was observed in platelets on thrombin. An initial rapid ele- vation in intracellular Ca 2+ was followed by a...

Ngày tải lên: 16/03/2014, 12:20

12 361 0
Báo cáo khoa học: " Host Immune Responses Against Hog Cholera Virus in Pigs Treated with an Ionized Alkali Mineral Complex" pot

Báo cáo khoa học: " Host Immune Responses Against Hog Cholera Virus in Pigs Treated with an Ionized Alkali Mineral Complex" pot

... vaccination pigs were variable in the level of maternal antibody titers (<1:4~1:256). Mean antibody titers of each group against HCV increased gradually after the vaccination of the attenuated ... one of the major diseases that are threatening the expanding Korean swine industry since 1947 [7]. Thus, the national eradication program of a virulent hog cholera virus...

Ngày tải lên: 07/08/2014, 15:20

5 364 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

... concentration of partially active GC vari- ants, as demonstrated by increased cellular GC activity, an increased concentration of lysosomal GC glyco- forms and increased colocalization of GC with the ... hydro- lase activity. That said, the fractional activity appears to be sufficient to ameliorate disease, when folding and trafficking efficiency is increased, resulting in an...

Ngày tải lên: 18/02/2014, 16:20

7 507 0
Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... and characterizing individual mutant proteins, these combinatorial approaches offer the important advantage of simultaneously generating libraries of protein variants, thus allowing a much larger number ... binding partner (stability- or affinity-based), one could divide a phage library in half and sort one half against a binding partner and the other half against an expr...

Ngày tải lên: 19/02/2014, 12:20

7 502 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) ... (5¢-TGGTACTCGAG CAATTTCTGAAGGTATCGAAG-3¢) and pyk2 (5¢-GG AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) an...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

Tài liệu Báo cáo khoa học: "Sentence generation as a planning problem" pptx

... the atoms subst(S, 1.self) and step(1) and a final state consisting of the following goal: A, u.¬subst (A, u) ∧ A, u.¬mustadjoin (A, u). We can then send the actions and the initial state and goal ... existence of the individual r before the utterance we are generating. We model this by marking r as hearer-new in the pragmatic knowledge base and as- signing...

Ngày tải lên: 20/02/2014, 12:20

8 339 0
Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... (LDA).Thisstatistical multivariate method is supervised. It searches for the variables containing the greatest interclass variance and the smallest intraclass variance, and constructs a linear combination ... Many parameters can be adjusted for increasing the efficiency of the algorithm. The data were analysed with a window of five wavenumbers, assuming that adjacent w...

Ngày tải lên: 21/02/2014, 03:20

6 555 0
Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

Báo cáo khoa học: 2-Pyrimidinone as a probe for studying the EcoRII DNA methyltransferase–substrate interaction docx

... stabilities of the adducts of C5 MTases with DNA duplexes containing AzaC, FC or 2P in place of the target C in the presence of AdoMet. The adducts of M.EcoRII with AzaC DNA [5] and M.HhaI with FC DNA ... methyl transfer was detected in the case of duplex I lacking the HhaI recognition sequence (data not shown). Therefore, as in the case of M....

Ngày tải lên: 07/03/2014, 15:20

9 437 0
Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

Báo cáo khoa học: Missense mutations as a cause of metachromatic leukodystrophy Degradation of arylsulfatase A in the endoplasmic reticulum potx

... acid-substituted ASAs via the proteasome In order to investigate the degradation pathway of amino acid-substituted ASAs in the ER, we used Ltk – Fig. 2. Immunoprecipitation of amino acid-substituted ASAs with structure-sensitive ... mechanisms cause ASA deficiency. In about half of the examined cases the mutant enzymes are retained in the ER [2,9,10], in the oth...

Ngày tải lên: 07/03/2014, 17:20

10 505 0
w