báo cáo khoa học: "Paroxysmal autonomic instability with dystonia in a patient with tuberculous meningitis: a case report" ppt

... competing interests. Authors’ contributions NAR, MAS, AJCS and DWL treated this patient and analyzed, interpreted the patient data re-garding paroxysmal autonomic instabilit y with dystonia and drafted ... describes an extremely rare combination of paroxysmal autonomic instability with dystonia and tuberculous meningitis. Paroxysmal autonomic instability with dyston...

Ngày tải lên: 11/08/2014, 02:21

... promoters lacUV5 and trc were amplified by PCR from vectors including the relevant genes. By using primers TEHA1: ACACAGATCTCTGCA- GGGCACCCCAGGCTTTACA and TEHA2: ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGAT- CCCGCGAAATTAATAC and TEHA8: ACACCCATGG- TATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI...

Ngày tải lên: 06/03/2014, 01:20

...

Ngày tải lên: 07/08/2014, 18:21

... to PSA normalization. Thequantitativedataareexpressedasthemean± SEM. Ordinal data are expressed as the median, w ith the range in parentheses. Times to PSA normalization were calculated using ... prostate cancer include radical prostatectomy, external beam radiation therapy, brachytherapy, and active surveillance. Both external beam radiation therapy (EBRT) and brachytherapy may be combined...

Ngày tải lên: 09/08/2014, 09:20

... affecting quantitative variation Data from several isofemale strain studies have been interpreted as indicating that a large percentage of the quantitative variation in morphological ... an analysis of variance (ANOVA), the between-line component of variance contains a quarter of the additive genetic variance and a quarter of the dominance var...

Ngày tải lên: 09/08/2014, 22:22

... substantially to the analysis and interpretation of data. All authors participated in manuscript writing and have read and approved the final manuscript. Competing interests The authors declare ... Republican AIDS Centre: 2007. 11. Murzalieva G, Kojokeev K, Samiev A, Aleshkina J, Kartanbaeva N, Botoeva G, Ablezova M, Jakab M: Tracking Global HIV/AIDS Initiatives and the Impact on the healt...

Ngày tải lên: 11/08/2014, 14:21

... accompanied by a decrease in T m ; and, for Y456W and F45 4A ⁄ Y45 6A, an increase in s 1 ⁄ 2 is associated with higher T m . Most notably, Y456W shows a 34-fold increase in half-life, and an increase ... mutagenesis approach was used, including alanine-scanning, site-saturation and deletion mutagenesis, and selected variants were characterized by biochemical and crystal-structur...

Ngày tải lên: 29/03/2014, 09:20

... penduncle’ — the ’sinus-veins’ and ’clustered hairs’ show a small overlap and therefore have more diagnostic value. In literature (reviewed in Aas, 1988), the distinction ... reliable distinctive feature. According to Flora Eu- ropaea (Tutin et al, 1964), it is up to 5 mm in pedunculate oak and between 18 and 25 mm in sessile oak....

Ngày tải lên: 08/08/2014, 19:21

... axioms of permutation invariance, scale invariance and the Dalton-Pigou principle of transfers. Mutual comparison of concentration measures was cal- culated with the Spearman ... 1 and r5 = row 5) was carried out as described above at Afsnee and with the Mann-Whitney test at Orsay (Siegel and Castellan, 1988). Because each central block at Afsne...

Ngày tải lên: 08/08/2014, 19:21

... or stressor and may produce anxiety in patients. Anxiety occurs in the preoperative phase as the patients antici- pate an unknown event with potent ial pain and changes in body image, as well as increased ... receive training so as to integr ate preoperative instructions into the routine nursing care. When relaxation techniques such as relaxing the muscles, taking deep and rhythmic br...

Ngày tải lên: 09/08/2014, 01:24