Báo cáo y học: "Cholestatic jaundice, acute kidney injury and acute pancreatitis secondary to the recreational use of methandrostenolone: a case report" potx

... his AAS use as the main culprit in b oth hi s acu te kidney injury and pancreatitis. Conclusion AAS use and misuse is being seen in an expanding population of patients because they are readily available and ... Queiroz AL, Ramos LM, Santos SQ, Barreto DM, Guimarães AA, Barbosa CA, Franco LM, Patrocínio RM: Acute kidney injury due to anabolic steroid and vitamin s...

Ngày tải lên: 11/08/2014, 00:23

... Yamana D, Yanagi T, Nanbu I, Tanaka K, Hirabayashi S, Tohyama J, Mizutani H, Ohba S, Katoh N, Ono Y: Intracaval invasion of left adrenal cortical carcinoma extending into the right atrium. Radiat ... instance of a renal lym- phoma. Intravascular extension of lymphoma is a rare clinical finding. An atypical pattern o f intra-abdominal spread of metastases and liver invasion wa...

Ngày tải lên: 10/08/2014, 23:21

... presentation: A 69-year old Mexican male had a pain in the maxillar right-canine region and a swelling of the submental and submandibular regions. Our examination revealed local pain, tachycardia, ... tachycardia, and hyperthermia (39°C). The bilateral submental and sub- mandibular regions had a 10-cm diameter swelling and well-delimitated erythematous, hyperthermia,...

Ngày tải lên: 11/08/2014, 00:22

... [5]. Case presentation A 50-year-old Caucasian man was admitted with an acute right hemiparesis, affecting his arm, leg and face, and a right homonymous hemianopia. His vascular risk factors included ... factors included a 25 pack-year smoking history and a previous myocardial infarction. An initial computed tomography (CT) head scan and m agnetic resonance imaging (MRI) s...

Ngày tải lên: 11/08/2014, 11:23

... cardiopulmonary bypass (CPB). Based on our animal data, we hypothesized that IL-6 and IL-8 would be early biomarkers of acute kidney injury. In animals, we and others demonstrated that AKI causes lung injury, ... per protocol. Study procedures Serum creatinine was measured at baseline and at least twice a day postoperatively and at least daily after postoperative day 3. Blo...

Ngày tải lên: 13/08/2014, 16:21

... using synchrotron radiation at a wavelength of 1.38 A ˚ , using a MAR 345 imaging plate on the protein crystallography beamline [28,29] at the Brazilian National Synchrotron Laboratory (Campinas, ... crystal form diffracted to 6 A ˚ with the rotating anode source, and was not further characterized. Table 1. Summary of X-ray data collection and crystallographic refinemen...

Ngày tải lên: 24/03/2014, 04:21

... analyzed as described [32]. The primer pair for nppa was F-GGCAACAGAA- GAGGCATCAGAG and R-GGAGCTGCTGCTTC CTCTCGGTC. The primer pair for b-actin was F- CCATTGGCAATGAGAGGTTCAG and R-T GAT GGAGTTGAAAGTGGTCTCG. Results Phenotypes ... 1A &1B). Pronounced pericardial edema accompanied by a linear arrangement of the ventricle and atrium which underwent bradycardia arrhythmia an...

Ngày tải lên: 10/08/2014, 10:20

... statistical analyses and drafted the manuscript. NAA performed migration assays and related statistical analyses. JML assisted with data acquisi- tion and analysis for molecular and cellular ... data analysis was performed in the DHLRI Bioinformatics/Computational Biology (BCB) Core using Data Mining Tool (Affymetrix, Santa Clara, CA) and Microarray Suite 5.0 (Affymetrix, Santa...

Ngày tải lên: 11/08/2014, 08:21

... severe schizophrenia: a multidisciplinary approach. Ment Health Phys Act 2009, 2:29-36. 16. Duraiswamy G, Thirthalli J, Nagendra HR, Gangadhar BN: Yoga therapy as an add-on treatment in the management of patients ... exercise therapy and found that while yoga therapy participants showed significantly reduced levels of psychopathology and greater quality of life when compared to...

Ngày tải lên: 11/08/2014, 15:22

... MCA, HB, AEE, and BF interpreted the p atients’ data in terms of haematological disease; MCA and BF also took part in writing the manuscript. FT analysed and interpreted the patients’ data regarding ... development of sarcoidosis in patients with lymphoma. Positron emission tomography-positive lesions do not always indicate malignancy and therefore a tissue biopsy is alway...

Ngày tải lên: 11/08/2014, 17:21