Báo cáo y học: " Coexistence of a colon carcinoma with two distinct renal cell carcinomas: a case report" pps

Báo cáo y học: " Coexistence of a colon carcinoma with two distinct renal cell carcinomas: a case report" pps

Báo cáo y học: " Coexistence of a colon carcinoma with two distinct renal cell carcinomas: a case report" pps

... al. [4] Renal cell carcinoma Other sites Beisland et al. [5] Renal cell carcinoma Esophageal carcinoma Kobayashi et al. [6] Papillary renal carcinoma Heart liposarcoma Gałazka et al. [7] Renal ... gallbladder Morelli et al. [15] Renal cell carcinoma Papillary renal carcinoma/ chromophobe cell carcinoma Petrolla et al. [16] Renal cell carcinoma Malignant...

Ngày tải lên: 11/08/2014, 00:23

6 348 0
Báo cáo y học: "Role of positron emission tomography-computed tomography in bronchial mucoepidermoid carcinomas: a case series and review of the literature" pdf

Báo cáo y học: "Role of positron emission tomography-computed tomography in bronchial mucoepidermoid carcinomas: a case series and review of the literature" pdf

... 1. Case 1 A 14-year-old Caucasian girl presented with a one-year history of cough and gradually progressive dyspnea. On clinical examination, decreased air entry was noted on the left side of ... significant uptake. Histological results of a biopsy taken from the mass were suggestive of low-grade MEC. Case 3 A 24-year-old Caucasian man presented with a one-year histo...

Ngày tải lên: 11/08/2014, 03:21

4 210 0
Báo cáo y học: " Coexistence of mal de Meleda and congenital cataract in a consanguineous Tunisian family: two case reports" ppsx

Báo cáo y học: " Coexistence of mal de Meleda and congenital cataract in a consanguineous Tunisian family: two case reports" ppsx

... Tunisian family: two case reports Jour- nal of Medical Case Reports 2010, 4:108 JOURNAL OF MEDICAL CASE REPORTS Bchetnia et al. Journal of Medical Case Reports 2010, 4:108 http://www.jmedicalcasereports.com/content/4/1/108 Open ... two female siblings aged 45 and 30 years, presented with a clinical association of mal de Meleda and congenital cataract. The two patien...

Ngày tải lên: 11/08/2014, 12:20

4 354 0
Báo cáo y học: " Coexistence of primary adenocarcinoma of the lung and Tsukamurella infection: a case report and review of the literature" doc

Báo cáo y học: " Coexistence of primary adenocarcinoma of the lung and Tsukamurella infection: a case report and review of the literature" doc

... that uses galactose as a carbon source. Adapted from Tsukamura and Kawakami [2] BioMed Central Page 1 of 4 (page number not for citation purposes) Journal of Medical Case Reports Open Access Case ... pulmo- nary lesion and the lack of radiographic improvement after 6 weeks of antibiotic therapy, the patient was again asked and eventually agreed to undergo a percutaneous CT-gui...

Ngày tải lên: 11/08/2014, 21:22

4 272 0
Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"

Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"

... demographic data. Mean age was 68 years old (quartile range: 59-77). The major ethnicities were European American (44%), African American (37%) and Hispanic Ameri- can (11%). Table 1. Demographics ... Our study showed that among those with OAB, only 52% had been diagnosed with or treated for urinary symptoms (OAB, LUTS and/or BPH). Fur- thermore, those with OAB had a worse qu...

Ngày tải lên: 25/10/2012, 11:35

4 522 0
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc

... CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢ GSTM2-revA ... 4 AS-6 ACAAAGCATGATGAGCTGCA CDS 326–345 – 8 AS-7 GAGTA GAGCTTCATCTTCTC CDS 397–426 – 1 AS-8 ACTGGTCAAGAATGTCATAA CDS 480–499 – 7 AS-9 CAGGTTTGGGAAGGCGTCCA CDS 524–543 524–543 0 AS-10 CA...

Ngày tải lên: 31/03/2014, 15:20

10 432 0
Báo cáo y học: "Effect of allergen-specific immunotherapy with purified Alt a1 on AMP responsiveness, exhaled nitric oxide and exhaled breath condensate pH: a randomized double blind study" ppsx

Báo cáo y học: "Effect of allergen-specific immunotherapy with purified Alt a1 on AMP responsiveness, exhaled nitric oxide and exhaled breath condensate pH: a randomized double blind study" ppsx

... placebo-controlled study of Alternaria alternata immunotherapy: Clinical efficacy and safety. Pediatr Allergy Immunol 2008, 19:67-75. 20. Asturias JA, Ibarrola I, Ferrer A, Andreu C, Lopez-Pascual ... (cat and dog), pollens (mixed grass, olive, Parietaria judaica, Artemisia, Platanus orientalis, Cupresus arizonica and Salsola kali), and moulds ( Alter- naria alternata, Aspergillus fumigatu...

Ngày tải lên: 08/08/2014, 21:20

11 546 0
Báo cáo y học: "Association of ENPP1 gene polymorphisms with hand osteoarthritis in a Chuvasha population" doc

Báo cáo y học: "Association of ENPP1 gene polymorphisms with hand osteoarthritis in a Chuvasha population" doc

... impressive association lead was found with the pooled rare alleles of the STR marker M06NR 1A, which was associated with a younger age at onset by a mean of about 3.5 years (Table 3). The major contribution to ... individuals were all Chuvashians (Caucasians) from small villages in the Chuvasha and Bashkirostan autonomies of the Russian Feder- ation. Their population is demograp...

Ngày tải lên: 09/08/2014, 06:23

9 411 0
Báo cáo y học: "Control of hyperuricemia in subjects with refractory gout, and induction of antibody against poly(ethylene glycol) (PEG), in a phase I trial of subcutaneous PEGylated urate oxidase" potx

Báo cáo y học: "Control of hyperuricemia in subjects with refractory gout, and induction of antibody against poly(ethylene glycol) (PEG), in a phase I trial of subcutaneous PEGylated urate oxidase" potx

... the development of a PEGylated recombinant mammalian uricase as an orphan drug for treating refractory gout. In a preclinical study, weekly administration of this mammalian PEG-uricase normalized urate levels ... activity, in 'early elimination' subjects 002, 011, and 013Time course of appearance of IgM and IgG antibodies against PEG-uri- case, and of plasma uricase a...

Ngày tải lên: 09/08/2014, 07:20

10 481 0
Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx

Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx

... Similarly, no association was detected with RA using haplotype analysis or when stratification by shared epitope carriage or by presence of rheumatoid factor was undertaken. This study was powered ... were initially selected for investigation because they had all been associated with RA in the Japanese population on single-point analysis, because the SNPs formed a haplotype associated...

Ngày tải lên: 09/08/2014, 08:22

5 407 0
Từ khóa:
w