... Portugal. Authors’ contributions EC analyzed and interpreted the data regarding the neurological presentation of the disease, and was the major contributor in writing the manuscript. AMS analyzed and ... interpreted the data regarding the endocrinological aspects of the case. CF analyzed the endocrinological data and is responsible for the follow-up of our patient...
Ngày tải lên: 11/08/2014, 00:22
... la Polyarthrite. References 1. Asahara H, Fujisawa K, Kobata T, Hasunuma T, Maeda T, Asanuma M, Ogawa N, Inoue H, Sumida T, Nishioka K: Direct evi- dence of high DNA binding activity of transcription factor AP-1 in rheumatoid ... nuclear staining with Hoechst H33258. Using image analysis software, the mean green intensity of the nuclear staining was quantified in 10 randomly s...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo y học: "Most nuclear systemic autoantigens are extremely disordered proteins: implications for the etiology of systemic autoimmunity" pps
... of the analy- sis, interpretation, and writing of the manuscript. BRST con- tributed invaluable informatics and statistical input as well as suggesting key aspects of the scaffolding model. Additional ... recently has come an appreciation that large regions of some proteins never fold at all, at least in the absence of a binding partner. Regions that lack a fixed t...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: " High-mobility group box protein 1 (HMGB1): an alarmin mediating the pathogenesis of rheumatic disease." docx
... models of severe sepsis and systemic infection. Crit Care 2007, 11:R122. 70. Abeyama K, Stern DM, Ito Y, Kawahara K, Yoshimoto Y, Tanaka M, Uchimura T, Ida N, Yamazaki Y, Yamada S, Yamamoto Y, Yamamoto ... proinflammatory mediators called alarmins. As a group, alarmins display distinct intracellular and extracellular activities, with potent stimulation of the innate immune syst...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: " Non infective severe aortic paravalvular leakage 7 years after surgery: the role of suture technique" pot
... replacement the factors that may mainly favor PVL formation are the annulus calcification and infections. We report a case of paraprosthetic l eakage, occurring seven years after AVR using a continuous ... after 7 years from the operation and we discuss the role of suture techni- que in this case of severe paraprosthetic leak without any clearly infection signs. Cas...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: " b-Lapachone induces heart morphogenetic and functional defects by promoting the death of erythrocytes and the endocardium in zebrafish embryo" docx
... was conducted and analyzed as described [32]. The primer pair for nppa was F-GGCAACAGAA- GAGGCATCAGAG and R-GGAGCTGCTGCTTC CTCTCGGTC. The primer pair for b-actin was F- CCATTGGCAATGAGAGGTTCAG ... damage, hyperactivation of PARP-1, which depletes NAD + andATPpoolsthatresultsin increased intracellular cytosolic Ca 2+ concentrations, and the activation of μ-calpain cysteine protease...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" pot
... contributions TK analyzed and interpreted the patient data and was a major contributor in writing the manuscript. JR analyzed the patient data and contributed in writing the manuscript. RP and BE analyzed and ... this coagulopathy, whereas use of aminoca- proic a cid in states of acquired hemophilia may some- times be associated with life-threatening complications in...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: "Acquired hemophilia as the cause of lifethreatening hemorrhage in a 94-year-old man: a case report" potx
... Open Access Acquired hemophilia as the cause of life- threatening hemorrhage in a 94-year-old man: a case report Theodoros Kelesidis * , Jonelle Raphael, Elizabeth Blanchard, Rekha Parameswaran Abstract Introduction: ... transfusion. Hospitalization was also complicated by bradycardia of unclear etiology, which started after infusion of aminocaproic acid. His activ...
Ngày tải lên: 11/08/2014, 07:20
Báo cáo y học: "Treatment of stasis dermatitis using aminaphtone: Benign giant mediastinal schwannoma presenting as cardiac tamponade in a woman: a case report" ppsx
... 5:61 http://www.jmedicalcasereports.com/content/5/1/61 Page 2 of 3 schwannoma presenting as cardiac tamponade in Reck- linghausen’s disease had a rapidly fatal outcome after pericardial drainage, whereas in our case, drainage pro- duced rapid ... et al.: Benign giant mediastinal schwannoma presenting as cardiac tamponade in a woman: a case report. Journal of Medical Ca...
Ngày tải lên: 11/08/2014, 00:22