báo cáo khoa học: " Inadvertent malposition of a permanent pacemaker ventricular lead into the left ventricle which was initially missed and diagnosed two years later: a case report" pptx

... 5:54 http://www.jmedicalcasereports.com/content/5/1/54 Page 2 of 5 CAS E REP O R T Open Access Inadvertent malposition of a permanent pacemaker ventricular lead into the left ventricle which was initially missed and diagnosed two years later: a case ... placement. Case presentation: We report a case of a 60-year-old Caucasian man with...

Ngày tải lên: 11/08/2014, 00:22

... longicornis, which has a wide geo- graphical distribution in Russia, eastern Asia, Austra- lia, and New Zealand, and has the potential to transmit pathogens including viruses, rickettsia and protozoan parasites ... act as vectors of disease-causing agents in humans and animals by injecting their saliva, which contains anticoagulants and other bioactive com- ponents as well...

Ngày tải lên: 16/03/2014, 10:20

... kDa) and DT -A subunit ( 25 kDa). Arrows in (B) indicate the mobilities of intact DT ( 62 kDa) and uncharacterized DT fragments (60, 35 and 12 kDa). Activation and translocation of diphtheria ... Biochemical characterization revealed that the neutral endosomal DT-degrading activity was due to a novel luminal 70-kDa furin enzyme, whereas the aspartic acid protease cath...

Ngày tải lên: 23/03/2014, 07:20

... site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI Y74W* WT* W11F ... maintaining the geometry of the active site. The availability of crystal structures of TIMs from 21 sources and the large database of TIM sequences from various sources facilita...

Ngày tải lên: 18/02/2014, 11:20

... 5¢-CGCCTCGAGCTATTTGGGCTCTT TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5 ¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢- CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAG CTAAGAGTCAG CTTGCACGTC-3 ¢; rOMM-64-III, 5¢-CGCGGATCCG...

Ngày tải lên: 18/02/2014, 17:20

... at the same time, distinct absorption bands of oxyheme appeared at 540 and 579 nm. Then, a broad band appeared at around 660 nm, and was maximal 9–12 min after initiation of the reaction. The ... vanished after 30 min, and instead, an absorption peak appeared at 637 nm, suggesting the formation of CO–verdoheme. The 637 nm band disappeared gradu- ally and was repl...

Ngày tải lên: 19/02/2014, 05:20

... 4 A ˚ of the cofactor, of which 15 are identical in the bacterial, trypanosomal and mammalian PDH. The binding of NADP + is similar to that in OaPDH, however, differ- ences do exist. First, at ... His453 and a water molecule. The C3-OH forms hydrogen-bonding interactions with the catalytic Lys184 and two asparag- ines (Asn188 and Asn102). Lys184 also interacts...

Ngày tải lên: 19/02/2014, 05:20

... substituents with amino acids of the antibody, and that the protein provided a partial steric hindrance of the distal face of the heme [2]. In addition, it was shown recently that 3A3 –MP8 was a more efficient catalyst ... This was shown by a progressive disappearance, in its absorption spectrum, of the soret band at 396 nm that is characteristic of the heme...

Ngày tải lên: 19/02/2014, 12:20

... First, whereas the overall exposed surface areas of the psy- chro- and the mesophilic enzymes are larger than for the thermophile enzyme, mainly as a result of larger area of apolar atoms, the meso- and ... 6, 501–523. 50 Feller G, Payan F, Theys F, Qian M, Haser R & Gerday C (1994) Stability and structural analysis of alpha-amylase from the antarctic psychroph...

Ngày tải lên: 19/02/2014, 16:20

... h and then cut with ClaI (C and D). DNA was separated by electrophoresis on an agarose gel and the ethidium bromide fluorescence recorded to quantify DNA (A and C). The DNA was then electrotransferred ... present and was independent of the size of the DNA fragment (Fig. 3A, lane 1). As mtDNA in vivo is negatively supercoiled it was also important to compare the...

Ngày tải lên: 20/02/2014, 11:20