báo cáo khoa học: " Inadvertent malposition of a permanent pacemaker ventricular lead into the left ventricle which was initially missed and diagnosed two years later: a case report" pptx

... 5:54http://www.jmedicalcasereports.com/content/5/1/54Page 2 of 5CAS E REP O R T Open Access Inadvertent malposition of a permanent pacemaker ventricular lead into the left ventricle which was initially missed and diagnosed two years later: a case ... placement. Case presentation: We report a case of a 60-year-old Caucasian man with a malpositioned transvenous permanent pacing lead into the left ventricle via a patent foramen ovale that was not ... ventricular pacing (A pace-Vsense) because of programmed, managed ventricular pacing (AAI ↔ DDD) at a heart rate of 60 be ats/min. The patient was discharged to home and was prescribedwarfarin...

Báo cáo khoa học: Molecular characterization of a blood-induced serine carboxypeptidase from the ixodid tick Haemaphysalis longicornis docx

... longicornis, which has a wide geo-graphical distribution in Russia, eastern Asia, Austra-lia, and New Zealand, and has the potential totransmit pathogens including viruses, rickettsia and protozoan parasites ... act as vectors of disease-causingagents in humans and animals by injecting their saliva, which contains anticoagulants and other bioactive com-ponents as well as pathogens, into the blood pool ... 34,799–808.45 Boldbaatar D, Sikalizyo Sikasunge C, Battsetseg B,Xuan X & Fujisaki K (2006) Molecular cloning and functional characterization of an aspartic protease from the hard tick Haemaphysalis longicornis....

Báo cáo khoa học: Endosomal proteolysis of diphtheria toxin without toxin translocation into the cytosol of rat liver in vivo pdf

... kDa) and DT -A subunit ( 25 kDa). Arrows in (B) indicate the mobilities of intact DT ( 62 kDa) and uncharacterized DT fragments (60, 35 and 12 kDa).Activation and translocation of diphtheria ... Biochemical characterization revealed that the neutral endosomalDT-degrading activity was due to a novel luminal 70-kDa furin enzyme,whereas the aspartic acid protease cathepsin D (EC 3.4.23.5) was ... blot analysisrevealed a strong afﬁnity for all anti-DT antibodies (horse a- PV and rabbit a- D4 or a- 1275) and similar speciﬁcitytowards the A- and B-subunits. Rabbit polyclonal anti-CTor anti-PE...

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIWT* W11F W11F ⁄ W168F GAACCTTTATTCGCTATTGGTACCGGTAAA KpnIY74W* WT* W11F ... maintaining the geometry of the active site. The availability of crystal structures of TIMs from 21 sources and the large database of TIMsequences from various sources facilitate an analysis of mutational ... mutationsMousumi Banerjee1, Hemalatha Balaram2 and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal...

Tài liệu Báo cáo khoa học: Identiﬁcation of a novel matrix protein contained in a protein aggregate associated with collagen in ﬁsh otoliths pdf

... 5¢-CGCCTCGAGCTATTTGGGCTCTTTCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCTGTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAAGAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGGATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5 ¢-CGCCTCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCACCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢-CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAG CTAAGAGTCAG CTTGCACGTC-3 ¢;rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGTGATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTTTCATCAT-3¢; ... genomic DNA con-tamination in the total RNA was conﬁrmed by lack of ampliﬁcation of a b-actin mRNA fragment by PCR using a pair of primers (5¢ -ATCACCATCGGCAACGAGAG-3¢ and 5¢-TGGAGTTGTAGGTGGTCTCGTG-3¢)...

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... at the same time, distinct absorption bands of oxyhemeappeared at 540 and 579 nm. Then, a broad bandappeared at around 660 nm, and was maximal 9–12 minafter initiation of the reaction. The ... vanishedafter 30 min, and instead, an absorption peakappeared at 637 nm, suggesting the formation of CO–verdoheme. The 637 nm band disappeared gradu-ally and was replaced by a new broad band ... band maxima of the azide-freeform at 405 nm and of the azide-bound form at421 nm, so the relative amounts of the nonbound and azide-bound forms were estimated directly from the values of absorbance...

Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of speciﬁcity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf

... 4 A ˚ of the cofactor, of which 15 are identical in the bacterial,trypanosomal and mammalian PDH. The binding of NADP+is similar to that in OaPDH, however, differ-ences do exist. First, at ... His453 and a water molecule. The C3-OH forms hydrogen-bondinginteractions with the catalytic Lys184 and two asparag-ines (Asn188 and Asn102). Lys184 also interacts with the carbonyl oxygen of Val129 ... of Gln75, adopts a similar conformation, where NE2donates a hydrogen bond to the adenine N7 and the nicotinamide ribose is hydrogen bonded to the carbo-nyl group of Val74 and amide of Ala76 and Asn102.The...

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

... substituents with amino acids of the antibody, and that the protein provided a partial sterichindrance of the distal face of the heme [2]. In addition,it was shown recently that 3A3 –MP8 was a more efﬁcientcatalyst ... This was shown by a progressive disappearance, in its absorption spectrum, of the soret band at 396 nm that is characteristic of the hememoiety. This degradation was less important in the case of the ... [12]. The purity of the sample was greaterthan 97%, based on MALDI-TOF mass spectrometry.Preparation of monoclonal antibodiesMP8 was covalently attached to keyhole limpet hemo-cyanin (KLH) and...

Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

... First,whereas the overall exposed surface areas of the psy-chro- and the mesophilic enzymes are larger than for the thermophile enzyme, mainly as a result of largerarea of apolar atoms, the meso- and ... 6,501–523.50 Feller G, Payan F, Theys F, Qian M, Haser R &Gerday C (1994) Stability and structural analysis of alpha-amylase from the antarctic psychrophileAlteromonas haloplanctis A2 3. Eur J Biochem ... side chain and carbonyl oxygen of Asp9, the side chains of Asp12, Gln13, Asp19, the car-bonyl oxygen of Asn21 and one water molecule in a pentagonal bipyramidal manner (Fig. 4A) . Sequencealignments...

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... h and then cut with ClaI (C and D).DNA was separated by electrophoresis on an agarose gel and the ethidium bromide ﬂuorescence recorded to quantify DNA (A and C). The DNA was then electrotransferred ... present and was independent of the size of the DNAfragment (Fig. 3A, lane 1). As mtDNA in vivo is negativelysupercoiled it was also important to compare the ability of mitoDC-81 to alkylate linear, ... mitoDC-81 alkylates mtDNA in mitochondria or cells. The reasons for the lack of alkylation of mtDNAwithin mitochondria by mitoDC-81 are unclear. The localconcentrations of mitoDC-81 and DNA, and the...

Xem thêm

Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thống chuyên đề điện xoay chiều theo dạng Nghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoại Nghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THz Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam đề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giải Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN Quản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninh Phát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninh Phát hiện xâm nhập dựa trên thuật toán k means Chuong 2 nhận dạng rui ro Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vật chuong 1 tong quan quan tri rui ro Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘI Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt nam QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ