báo cáo khoa học: "Citrobacter freundii infection after acute necrotizing pancreatitis in a patient with a pancreatic pseudocyst: a case report" docx

báo cáo khoa học: "Citrobacter freundii infection after acute necrotizing pancreatitis in a patient with a pancreatic pseudocyst: a case report" docx

báo cáo khoa học: "Citrobacter freundii infection after acute necrotizing pancreatitis in a patient with a pancreatic pseudocyst: a case report" docx

... 5:51 http://www.jmedicalcasereports.com/content/5/1/51 Page 2 of 4 CAS E REP O R T Open Access Citrobacter freundii infection after acute necrotizing pancreatitis in a patient with a pancreatic pseudocyst: a case ... During treatment our patient progressed satisfactorily. A week after starting the treatment, he felt well and the abdominal pain gradually dec...

Ngày tải lên: 11/08/2014, 00:22

4 284 0
Báo cáo khoa học: "Pulse contour analysis after normothermic cardiopulmonary bypass in cardiac surgery patients" pdf

Báo cáo khoa học: "Pulse contour analysis after normothermic cardiopulmonary bypass in cardiac surgery patients" pdf

... measurement as already described. Statistical analysis All data are expressed as the mean and standard error of the mean. Statistical analysis was performed by linear regression analysis. The bias and ... symptomatic peripheral artery stenosis. Perioperative management Oral premedication was 0.1 mg/kg midazolam. In all patients a femoral artery was cannulated with a 4-Fr cannula (Puls...

Ngày tải lên: 12/08/2014, 23:20

6 279 0
Tài liệu Báo cáo khoa học: Unique features of recombinant heme oxygenase of Drosophila melanogaster compared with those of other heme oxygenases studied docx

Tài liệu Báo cáo khoa học: Unique features of recombinant heme oxygenase of Drosophila melanogaster compared with those of other heme oxygenases studied docx

... the last 21 amino acids was cloned and further expressed in Escherichia coli. The truncated enzyme was obtained in high yield as a soluble, catalytically active protein, making it available for ... of Drosophila melanogaster compared with those of other heme oxygenases studied Xuhong Zhang 1 , Michihiko Sato 2 , Masanao Sasahara 1 , Catharina T. Migita 3 and Tadashi Yoshida 1 1 Depart...

Ngày tải lên: 19/02/2014, 12:20

12 453 0
Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

Tài liệu Báo cáo khoa học: Identification of critical active-site residues in angiotensin-converting enzyme-2 (ACE2) by site-directed mutagenesis docx

... R1098Q in somatic ACE (sACE; equivalent to Arg522 in tACE) have a dramatic effect [18], with the mutation causing increased activity with the angiotensin I substrate relative to wild-type in the absence ... determination Protein concentrations were determined using the bicincho- ninic acid assay with BSA as standard [30]. PNGase F treatment PNGase F treatment (New England Biolab...

Ngày tải lên: 20/02/2014, 01:20

9 789 2
Báo cáo khoa học: Identification of an osteopontin-like protein in fish associated with mineral formation pot

Báo cáo khoa học: Identification of an osteopontin-like protein in fish associated with mineral formation pot

... CGCTCCAGCCGCTGAACTCCTGAAGC SaOP2-F02 CCACCCCTCAGCCCATCGACCCTACC SaOP3-F03 GGCGGGACCTGACACCACCACTGACA SaOP2-R04 GGTAGGGTCGATGGGCTGAGGGGTGG SaOPreal-FW AAAACCCAGGAGATAAACTCAAGACAACCCA SaOPreal-RV AGAACCGTGGCAAAGAGCAGAACGAA SaRPL2 7a- FW ... AGAACCGTGGCAAAGAGCAGAACGAA SaRPL2 7a- FW AAGAGGAACACAACTCACTGCCCCAC SaRPL2 7a- RV GCTTGCCTTTGCCCAGAACTTTGTAG Fig. 1. SaOP-L full-length cDNA. (A) cDNA fragm...

Ngày tải lên: 23/03/2014, 07:20

12 445 0
Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx

Báo cáo khoa học: Role of glutaredoxin 2 and cytosolic thioredoxins in cysteinyl-based redox modification of the 20S proteasome docx

... at least partially degraded to reach inside the proteasome, we first eval- uated Grx2 degradation using SDS–PAGE (Fig. 5A) . Degradation of Grx2 was achieved by incubating n-PT with Grx2 in standard ... S 3A) . As shown in supplementary Fig. S3B, after 30 min incubation with the proteasome, a 4898 kDa Grx2 fragment was generated (Table 1). Although Grx2 fragmentation was greatly in...

Ngày tải lên: 23/03/2014, 07:20

14 364 0
Báo cáo khoa học: " Host Immune Responses Against Hog Cholera Virus in Pigs Treated with an Ionized Alkali Mineral Complex" pot

Báo cáo khoa học: " Host Immune Responses Against Hog Cholera Virus in Pigs Treated with an Ionized Alkali Mineral Complex" pot

... vaccination pigs were variable in the level of maternal antibody titers (<1:4~1:256). Mean antibody titers of each group against HCV increased gradually after the vaccination of the attenuated ... after vaccination. Each group w as treated w ith Pow erFeelTMsprayed diet as 0.05% (w /w ) in a final concentration (T-1, n=10), a diet mixed with SuperFeedTMas 3%(w /w ) in a f...

Ngày tải lên: 07/08/2014, 15:20

5 364 0
Báo cáo khoa hoc:" Potential benefit from using identified major gene in BLUP evaluation with truncation and optimal selection" ppt

Báo cáo khoa hoc:" Potential benefit from using identified major gene in BLUP evaluation with truncation and optimal selection" ppt

... that with BLUP selection the advantage of using information on a major gene with additive effect can be maintained after the favourable allele is fixed. This advantage ... normal distribution with mean zero and variance a U. 2 The alleles at the major locus were chosen at random with p probability of an allele being the favourable A g...

Ngày tải lên: 09/08/2014, 18:21

19 214 0
w