báo cáo khoa học: "Superior canal dehiscence in a patient with three failed stapedectomy operations for otosclerosis: a case report" pps

báo cáo khoa học: "Superior canal dehiscence in a patient with three failed stapedectomy operations for otosclerosis: a case report" pps

báo cáo khoa học: "Superior canal dehiscence in a patient with three failed stapedectomy operations for otosclerosis: a case report" pps

... CAS E REP O R T Open Access Superior canal dehiscence in a patient with three failed stapedectomy operations for otosclerosis: a case report Martin Lehmann, Jörg Ebmeyer, Tahwinder Upile, ... Sudhoff * Abstract Introduction: This case illustrates that superior semicircular canal dehiscence syndrome can be associated with a “pseudo"-conductive hearing...

Ngày tải lên: 11/08/2014, 00:22

3 265 0
Báo cáo khoa học: "Hedge classification in biomedical texts with a weakly supervised selection of keywords" doc

Báo cáo khoa học: "Hedge classification in biomedical texts with a weakly supervised selection of keywords" doc

... equiva- lents that were eliminated due to the noise present in the automatically generated training data. We manually examined all keywords that had a P (spec) > 0.5 given as a standalone instance ... Com- putational Natural Language Learning Conference, pages 25–32, Edmonton, Canada, May-June. Associa- tion for Computational Linguistics. James G. Shanahan, Yan Qu, and Janyce Wiebe...

Ngày tải lên: 31/03/2014, 00:20

9 407 0
Báo cáo khoa học: "Inter-observer variability in contouring the penile bulb on CT images for prostate cancer treatment planning" doc

Báo cáo khoa học: "Inter-observer variability in contouring the penile bulb on CT images for prostate cancer treatment planning" doc

... penile bulb in the radical irradiation of clinically localised prostate carcinoma: A comparison between MRI and CT prostatic apex definition in 3DCRT, Linac-IMRT and Helical Tomotherapy. Radiother ... Cozzarini 2 , Eleonora Maggiulli 1 , Gianni Fellin 3 , Tiziana Rancati 4 , Riccardo Valdagni 4 , Vittorio Vavassori 5 , Sergio Villa 6 and Claudio Fiorino 1 Abstract Several investigations...

Ngày tải lên: 09/08/2014, 09:21

11 294 0
báo cáo khoa học: "SET-NUP214 fusion in acute myeloid leukemia- and T-cell acute lymphoblastic leukemia-derived cell lines" ppsx

báo cáo khoa học: "SET-NUP214 fusion in acute myeloid leukemia- and T-cell acute lymphoblastic leukemia-derived cell lines" ppsx

... 5'-TGA CGA AGA AGG GGA TGA GGA T-3'; NUP214 exon 18 reverse: 5'-ATC ATT CAC ATC TTG GAC AGC A- 3'. (ii) SET intron 8/exon 8 forward: 5'-TCA GGA GGA TGA AGG AGA AGA-3'; NUP214 ... agctctgtttttttttttgttttgttttgttttttaattttggacacggtct SET ttctggtataaagctctcaaatgtgaccatgtgaatctgggtgggataatgg |||||||||||||||||||||||||| MEGAL ttctggtataaagctctcaaatgtgatttgtctccattacag...

Ngày tải lên: 10/08/2014, 22:20

5 199 0
báo cáo khoa học: "Respiratory failure presenting in H1N1 influenza with Legionnaires disease: two case reports" docx

báo cáo khoa học: "Respiratory failure presenting in H1N1 influenza with Legionnaires disease: two case reports" docx

... patients who presented in 2009 with coexisting H1N1 virus and Legionella infections: a 69-year- old Caucasian man and a 71-year-old Caucasian woman. In our cases all the signs and symptoms, including ... heart rate 46 be ats per minute), she was intubated and mechanically ventilated. RT-PCR on a broncoalveolar lavage specimen was positive for H1N1 influenza infection. On admissi...

Ngày tải lên: 10/08/2014, 23:20

5 398 0
Báo cáo khoa học: "Sales of oseltamivir in Norway prior to the emergence of oseltamivir resistant influenza A(H1N1) viruses in 2007–08" pps

Báo cáo khoa học: "Sales of oseltamivir in Norway prior to the emergence of oseltamivir resistant influenza A(H1N1) viruses in 2007–08" pps

... the manuscript; KB, OH and SD all participated in the drafting of the manu- script and PA participated in the initiation of the data col- lection, analysis and drafting of the manuscript. Acknowledgements We ... complete data on all medicines sold from the wholesalers to Norwegian pharmacies, hospitals and nursing homes. Information of sales is available as pack- ages sold and as number o...

Ngày tải lên: 12/08/2014, 04:21

4 316 0
Báo cáo khoa học: " Sales of oseltamivir in Norway prior to the emergence of oseltamivir resistant influenza A(H1N1) viruses in 2007–08" pot

Báo cáo khoa học: " Sales of oseltamivir in Norway prior to the emergence of oseltamivir resistant influenza A(H1N1) viruses in 2007–08" pot

... extracted data from the Norwegian Drug Wholesales Statistics Database. This database is adminis- tered by the Norwegian Institute of Public Health and contains complete data on all medicines ... data from the Norwegian Prescription Database (NorPD). This database was established in 2004 and is administered by the Norwegian Institute of Public Health. All Norwegian pharmacies report all ......

Ngày tải lên: 12/08/2014, 04:21

4 204 0
Báo cáo khoa học: "Antinuclear Antibodies (ANA) in Gordon Setters with Symmetrical Lupoid Onychodystrophy and Black Hair Follicular Dysplasia" ppsx

Báo cáo khoa học: "Antinuclear Antibodies (ANA) in Gordon Setters with Symmetrical Lupoid Onychodystrophy and Black Hair Follicular Dysplasia" ppsx

... cutaneous affections described here have many features in common with the human skin disease alopecia areata which has a peak inci- dence in children and young adults. Alopecia areata has a genetic ... the head and neck are less Antinuclear antibodies 327 Acta vet. scand. vol. 42 no. 3, 2001 Table 1. Frequencies of antinuclear antibodies (ANA) and antibodies against extractable nuc...

Ngày tải lên: 12/08/2014, 15:20

7 281 0
Báo cáo khoa học: Ferrous Campylobacter jejuni truncated hemoglobin P displays an extremely high reactivity for cyanide – a comparative study ppt

Báo cáo khoa học: Ferrous Campylobacter jejuni truncated hemoglobin P displays an extremely high reactivity for cyanide – a comparative study ppt

... Coletta 2,3 , Marco Nardini 4 , Martino Bolognesi 4 , Alessandra Pesce 5 , Michel Guertin 6 , Paolo Visca 1,7 and Paolo Ascenzi 1,7 1 Dipartimento di Biologia and Laboratorio Interdipartimentale ... proteins that have been annotated as canonical double-domain rhodaneses, although it contains two putative proteins with a rhodanese (RHOD) module (NCBI accession numbers CAL34666 and CAL34648...

Ngày tải lên: 16/03/2014, 06:20

13 366 0
báo cáo khoa học: "Induction of endogenous γ-globin gene expression with decoy oligonucleotide targeting Oct-1 transcription factor consensus sequence" pps

báo cáo khoa học: "Induction of endogenous γ-globin gene expression with decoy oligonucleotide targeting Oct-1 transcription factor consensus sequence" pps

... Gel shifting Oct-1 oligos. Oct-1 binding probe (sense strand) 5' -CTGATACGATTTGCATACTGACGT- 3' Oct-1 binding probe (anti-sense strand) 3' -GACTATGCTAAACGTATGACTGCA- 5' 2. ... hemin, an effective γ- globin gene inducer, in parallel experiments. At various time points, the cells were harvested and total RNA was isolated using an RNeasy mini kit (Qiagen, Santa Clarita, CA)....

Ngày tải lên: 10/08/2014, 22:20

11 359 0
w