báo cáo khoa học: "Metallic nickel nano- and fine particles induce JB6 cell apoptosis through a caspase-8/AIF mediated cytochrome c-independent pathway" pps

báo cáo khoa học: "Metallic nickel nano- and fine particles induce JB6 cell apoptosis through a caspase-8/AIF mediated cytochrome c-independent pathway" pps

báo cáo khoa học: "Metallic nickel nano- and fine particles induce JB6 cell apoptosis through a caspase-8/AIF mediated cytochrome c-independent pathway" pps

... purposes) Journal of Nanobiotechnology Open Access Research Metallic nickel nano- and fine particles induce JB6 cell apoptosis through a caspase-8/AIF mediated cytochrome c-independent pathway Jinshun Zhao 1 , ... necrosis induced by metallic nickel nano- or fine particles, a dual staining assay using YP and PI was applied. The results showed that bot...

Ngày tải lên: 11/08/2014, 00:22

13 162 0
Báo cáo khoa học: Rhodanese–thioredoxin system and allyl sulfur compounds Implications in apoptosis induction docx

Báo cáo khoa học: Rhodanese–thioredoxin system and allyl sulfur compounds Implications in apoptosis induction docx

... Nakamura H (2004) Thioredoxin as a key molecule in redox signaling. Antioxid Redox Signal 6, 15–17. 65 Tanaka T, Hosoi F, Yamaguchi-Iwai Y, Nakamura H, Masutani H, Ueda S, Nishiyama A, Takeda ... Lanes 2–8, proteolysis products of RhdA-PS (lane 1) at 0, 5, 10, 15, 20, 30, 60 min and overnight incubation, respectively. a and ‘b’ bands are the parent and daughter bands, at about 29.7...

Ngày tải lên: 07/03/2014, 06:20

16 312 0
báo cáo khoa học: " Human Papillomaviruses, 16INK4a and Akt expression in basal cell carcinoma" potx

báo cáo khoa học: " Human Papillomaviruses, 16INK4a and Akt expression in basal cell carcinoma" potx

... performed PCR analysis, participated in data acquisition and drafted the manuscript; AC performed data acquisition and clinical analysis, participated in PCR analysis and drafted the manuscript; ... histological analysis; PP participated in the data acquisition and in clinical analysis; PF participated in the data acquisition and in clinical analysis; RC participated in the stud...

Ngày tải lên: 10/08/2014, 10:21

24 288 0
Báo cáo khoa học: "Most common genotypes and risk factors for HCV in Gaza strip: a cross sectional study" potx

Báo cáo khoa học: "Most common genotypes and risk factors for HCV in Gaza strip: a cross sectional study" potx

... the molecular genetic studies and the statis- tical analysis and drafted the manuscript. SZ carried out and personally financed the molecular genetic studies and statistical analysis. AYAJ helped ... MK, Bakr I, El-Hoseiny M, Arafa N, Hassan A, Ismail S, Anwar M, Attala M, Rekacewicz C, Zalata K, Abdel-Hamid M, Esmat G, Fontanet A: HCV-related morbidity in a rural community of Egy...

Ngày tải lên: 12/08/2014, 04:22

7 439 0
Báo cáo khoa học: Chronic high-dose morphine treatment promotes SH-SY5Y cell apoptosis via c-Jun N-terminal kinase-mediated activation of mitochondria-dependent pathway pdf

Báo cáo khoa học: Chronic high-dose morphine treatment promotes SH-SY5Y cell apoptosis via c-Jun N-terminal kinase-mediated activation of mitochondria-dependent pathway pdf

... of morphine treatment on the release of cytochrome c and the activation of caspase-9 and caspase-3 in SH-SY5Y cells by western blot analysis. Because activation of caspase-9 and caspase-3 is required ... of methadone on human lung cancer cells. Proc Natl Acad Sci USA 89, 1169–1173. 33 Kuida K, Haydar TF, Kuan CY, Gu Y, Taya C, Kara- suyama H, Su MS, Rakic P & Flavell RA (1998) Red...

Ngày tải lên: 16/03/2014, 01:20

15 244 0
Báo cáo khoa học: Ras oncogene induces b-galactoside a2,6-sialyltransferase (ST6Gal I) via a RalGEF-mediated signal to its housekeeping promoter pptx

Báo cáo khoa học: Ras oncogene induces b-galactoside a2,6-sialyltransferase (ST6Gal I) via a RalGEF-mediated signal to its housekeeping promoter pptx

... mst172 (5¢-GGATGGCACCGGCAGACATG-3¢) and mst171 (5¢-CACAGAAATGGGATCAGGCC-3¢). Both human H-Ras and K-Ras cDNA were obtained from Cancer Research UK. Human H-Ras cDNA probe was isolated from an EcoRI digestion of H-Ras V12 cDNA ... glycoprotein oligosaccharides N-linked to asparagine: enzymatic c harac terization of a Galb1,3(4)GlcNAc :a2 ,3-sialyl- transferase and a Gal b1,4GlcNA c :...

Ngày tải lên: 16/03/2014, 18:20

12 369 0
Báo cáo khoa học: " Water extraction by tree fine roots in the forest floor of a temperate Fagus-Quercus forest" pdf

Báo cáo khoa học: " Water extraction by tree fine roots in the forest floor of a temperate Fagus-Quercus forest" pdf

... daily throughfall and stand microcli- matological data as well as the humus mois- ture content at a weekly interval as input data. After solving the water balance equation, ... part of a comparative anal- ysis of the water and nutrient cycles in three forest and heathland stands that rep- resent early, mid and late stages of a sec- ond...

Ngày tải lên: 09/08/2014, 04:20

17 337 0
Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

Tài liệu Báo cáo khoa học: Hypothalamic malonyl-CoA and CPT1c in the treatment of obesity pptx

... Thus, the brain can directly sense and respond to changes in nutrient availability and composition to affect body weight and adiposity. Abbreviations ACC, acetyl-CoA carboxylase; AMPK, 5¢ AMP-activated ... Hypo- thalamic AMPK and fatty acid metabolism mediate thyroid regulation of energy balance. Nat Med 16, 1001–1008. 33 Lage R, Vazquez MJ, Varela L, Saha AK, Vidal-Puig A, Nogueiras...

Ngày tải lên: 14/02/2014, 22:20

7 679 0
Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx

Tài liệu Báo cáo khoa học: X-ray crystallographic and NMR studies of pantothenate synthetase provide insights into the mechanism of homotropic inhibition by pantoate docx

... structure of A. thaliana PS (Fig. S5 and Table S1) shows that it has a large loop at the dimer interface and fewer energetically favorable N-terminal and C-terminal interdomain interactions, such as the ... [7], and from the plants Oryza sativa [8], Arabidopsis thaliana [9,10] and Lotus japonicus [8]. Analysis of the primary sequences of this enzyme from E. coli, M. tuberculosis...

Ngày tải lên: 16/02/2014, 09:20

16 791 0
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

... 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA ACAAUGUGAAA GCAAUGUGAUA 5′ 3′ UAAAUGUGAAU ACUAAGAGUAA GCAAUGUGAUA IL6R mRNA mut 1 5′ 3′ UAAAUGUGAAU ACAAUGUGAAA GCUAAGAGUUA IL6R ... 5′3′ 3′ UAUAAGAGUAU CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′...

Ngày tải lên: 18/02/2014, 04:20

9 541 0
w