báo cáo khoa học: "Atomic force microscopy: a powerful tool for high-resolution imaging of spermatozoa" ppt
... Katayama E, Yanagida T: Dynein arms are oscillating force generators. Nature 1998, 393:711-714. 22. Sakakibara H, Kojima H, Sakai Y, Katayama E, Oiwa K: Inner-arm dynein c of Chlamydomonas flagella ... the acrosomal region may often lead to the loss of functional competence of the sperma- tozoa. The major advantage of AFM in pathological stud- ies of spermatozoa is that it allows...
Ngày tải lên: 11/08/2014, 00:22
... immediately upstream of the start codon (ATG). Primers with the fol- lowing sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; ... dissemination and assembly of detoxification pathways that can form part of genomic islands and have both pathogenicity and degradation functions [39]....
Ngày tải lên: 07/03/2014, 12:20
... Fisica e Astronomia, Università di Catania via S. Sofia 64, 95123 Catania, Italy 2 CNR-IMM MATIS, via S. Sofia 64, I-95123 Catania, Italy 3 Laboratory for Molecular Surface and Nanotechnology (LAMSUN), Department ... AFM analyses using the SPMLabAna- lyses V7.00 software that define each grain area by the surface image sectioning of a plane that was positioned at half grain height. In t...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo hóa học: " Atomic Force Microscopy Study of Protein– Protein Interactions in the Cytochrome CYP11A1 (P450scc)-Containing Steroid Hydroxylase System" docx
... maximum at h max = 4.0 ± 1.0 nm are, in fact, the ternary d-CYP1 1A1 /Ad/AdR complexes (Table 3). It is to be noted that formation of ternary d- CYP1 1A1 /Ad/AdR complexes (as well as formation of binary ... activity assays clearly demonstrate that the monomerization procedure does not significantly alter the functionality of CYP1 1A1 . AFM of AdR and Ad Visualization of the AdR and...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: " Atomic Force Microscopy Study of the Kinetic Roughening in Nanostructured Gold Films on SiO2" ppt
... the Au nanometric grains forming the film can be obtained. The XEI software for the analyses of the AFM images allow to obtain the distribution of the grains radii, R, and of the grains areas S ... scales as L a , and eventually reaches a saturation F. Ruffino (&) M. G. Grimaldi Dipartimento di Fisica e Astronomia, MATIS CNR-INFM, Universita ` di Catania, via S. So a 64, I-95...
Ngày tải lên: 22/06/2014, 01:20
báo cáo khoa học: " Atomic Force Microscope nanolithography on chromosomes to generate single-cell genetic probes" doc
... sebastiano.dibucchianico@cc.univaq.it 1 Department of Basic and Applied Biology, University of L’Aquila, Via Vetoio 1, L’Aquila 67100, Italy Full list of author information is available at the end of the article Di Bucchianico ... Ultramicroscopy 2002, 93:83-9. 7. Di Bucchianico S, Venora G, Lucretti S, Limongi T, Palladino L, Poma A: Saponaria officinalis karyology and karyotype by...
Ngày tải lên: 11/08/2014, 00:23
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... spectral data from the RNase A deamidation samples of Fig. 8. Deamidation at an individual residue of a specific product causes a 1 Da increase in any fragment ion containing that residue. The average ... mixtures, a dramatic advantage of the top-down approach is that a final separation stage can be done in the FT MS instrument. For example, after rough separa- tion of the p...
Ngày tải lên: 18/02/2014, 16:20
Báo cáo khoa học: Mutagenesis at the a–b interface impairs the cleavage of the dystroglycan precursor doc
... forward: 5¢-TTTAACAGCAACAGCGCGCTC ATGTATGGCCTG-3¢ Q55 9A reverse: 5¢-CAGGCCATACATGAGCGCGCT GTTGCTGTTAAA-3¢ M56 1A forward: 5¢-AGCAACAGCCAGCTCGCGTAT GGCCTGCCTGAC-3¢ M56 1A reverse: 5¢-GTCAGGCAGGCCATACGCGAG CTGGCTGTTGCT-3¢ Y56 2A ... 5 ¢-CTCATGTATGGCCTGGCTGAC AGCAGCCATGTG-3¢ P56 5A reverse: 5¢-CACATGGCTGCTGTCAGCCAG GCCATACATGAG-3¢ S65 4A forward: 5¢-CAGAACATCACTCGGGGCGC TATCGTGGTGGAATGGAC...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: Syndecan-4 is a signaling molecule for stromal cell-derived factor-1 (SDF-1)/ CXCL12 pptx
... stromal cell-derived factor (SDF) -1alpha. Glycobiology 10, 21– 29. 34 Valenzuela-Fernandez A, Palanche T, Amara A, Mage- rus A, Altmeyer R, Delaunay T, Virelizier JL, Baleux F, Galzi JL & Arenzana-Seisdedos ... RNA; FBS, fetal bovine serum; GAG, glycosaminoglycan; HS, heparan sulfate; JNK ⁄ SAPK, Jun N-terminal ⁄ stress- activated protein kinase; MAPK, mitogen-activated-protein kinase...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: "TAG''''s as a Grammatical Formalism for Ceneration" doc
... As Kmch and Jmhi point out, this means that a TAG is incomplete ms an account of the structure of a natural language, e.g. a TAG grammar wW contain ~th an active and a passive form of ... TAG's as a Grammatical Formalism for Ceneration David D. McDonald and James D. Pus~ejovsky Departmmt of Compute~ and Information Scienc~ Un/vemty of Mam,dzm~tm at A...
Ngày tải lên: 24/03/2014, 02:20