báo cáo khoa học: "Rapid self-assembly of DNA on a microfluidic chip" docx

... University of Alberta, Edmonton, Alberta, Canada Email: Yao Zheng - zheng@ualberta.ca; Tim Footz - tfootz@ualberta.ca; Dammika P Manage - manage@ece.ualberta.ca; Christopher James Backhouse* ... information upon the dynamics of the self-assembly process. Background There has been a rapid growth in the number of applica- tions that are based upon DNA self-assembly, ranging from...

Ngày tải lên: 11/08/2014, 00:22

... which such a dictionary algo- rithm is necessary. Indexing and searching of databases consisting of unformatted natural language text is one such application. The proliferation of personal comput- ... a parallel dictionary is to seri- ally broadcast all of the words in a given set. Processors that contain a broadcast word check off the appropriate status bits. When all...

Ngày tải lên: 24/03/2014, 02:20

... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ⁄ PDIP46 ⁄ SKAR (A) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT pYESTrp2 ... GCGGGATCCCACACCATTTTGCTGGTACA ATAAGAATGCGGCCGCCTATTTCCCAGCCTGTTGGGCCTG pGEX-4T1 ⁄ PDIP46 ⁄ SKAR(L7) GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAA...

Ngày tải lên: 19/02/2014, 05:20

... transcriptional activation and repression, regulation of alternative splicing, regula- tion of mRNA stability, translational activation or repression and RNA packaging. It was also shown recently that a Y-box ... Schnuchel A, Holak TA & Marahiel MA (1995) Mutational analysis of the puta- tive nucleic acid-binding surface of the cold-shock domain, CspB, revealed an essential rol...

Ngày tải lên: 23/03/2014, 09:21

... 206, 43–48. 61 Hiraga S-I, Hagihara-Hayashi A, Ohya T & Sugino A (2005) DNA polymerases alpha, delta, and epsilon localize and function together at replication forks in Saccharomyces cerevisiae. Genes ... cycle arrest at the initia- tion step of human chromosomal DNA replication causes DNA damage. J Cell Sci 17, 4897–4908. 44 Nakamura H, Morita T, Masaki S & Yoshida S (1984...

Ngày tải lên: 30/03/2014, 10:20

... stress wave propagation method and its application. IV. Application to qua - lity evaluation of hinoki (Chamaecyparis obutusa) forests, Mokuzai Gakkais - hi/Journal of the Japan Wood Research Society, ... felled and remeasured. The goal of this study was to contri - bute to the validation of the Rigidimeter, as a fast non-destructive and reliable tool for rapid evaluation of MOE,...

Ngày tải lên: 08/08/2014, 14:20

... small or it is a locally separated one. When the patient is in a supine position, a small pneumothorax usually locates in the antero- apical or antero-basal space [20]. As a result, examination ... from a car accident, and arrived with dyspnea, tachycardia, hypotension and desaturation requiring mechanical ventilation. (a) The supine chest radi- ograph did not enable a diagnosis...

Ngày tải lên: 13/08/2014, 02:24

... cellular model of Parkinson’s disease pathogenesis Tiziana Alberio 1 , Alessandra Maria Bossi 2 , Alberto Milli 2 , Elisa Parma 1 , Marzia Bruna Gariboldi 1 , Giovanna Tosi 3 , Leonardo Lopiano 4 and ... Pro transmis- sion scanner (Epson, Nagano, Japan) and analyzed with imagemaster 2d platinum software, version 5.0 (GE Healthcare). Spots were detected automatically by the soft- ware and ma...

Ngày tải lên: 15/02/2014, 01:20

... Bhattacharya AA, Zunszain PA, Ghuman J, Bhagavan NV & Curry S (2003) Structural basis of albumin-thyroxine interac- tions and familial dysalbuminemic hyperthyroxinemia. Proc Natl Acad Sci USA, 100, ... Crystallo- graphic analysis reveals common modes of binding of medium and long-chain fatty acids to human serum albumin. J Mol Biol, 303, 721–732. 18 Petitpas I, Bhattacharya AA, Twin...

Ngày tải lên: 16/02/2014, 14:20

... active site. Thus, the conformational switch of the a2 -helix could be of functional relevance and be associated with either an ‘open’ nonfunctional confor- mation or a ‘closed’ conformation adopted ... three-stranded b-sheets, each one consisting of the antiparallel b-strands b6, b7 of one monomer and strand-b8 of the other. Solvent-accessible surface [15] calculations show that...

Ngày tải lên: 19/02/2014, 00:20