báo cáo khoa học: " A Viral Platform for Chemical Modification and Multivalent Display" pdf

báo cáo khoa học: " A Viral Platform for Chemical Modification and Multivalent Display" pdf

báo cáo khoa học: " A Viral Platform for Chemical Modification and Multivalent Display" pdf

... purposes) Journal of Nanobiotechnology Open Access Research A Viral Platform for Chemical Modification and Multivalent Display David S Peabody* Address: Department of Molecular Genetics and Microbiology and ... protein cDNA clone, but systems also exist that facilitate random mutagenesis and selection of coat mutants having altered RNA binding [9] and particle assembly...

Ngày tải lên: 11/08/2014, 00:22

8 326 0
Báo cáo khoa học: "A Support Platform for Event Detection using Social Intelligence" pot

Báo cáo khoa học: "A Support Platform for Event Detection using Social Intelligence" pot

... this system was the Ushahidi platform, 1 which has high up- take for social media surveillance and information dissemination purposes across a range of organ- isations. The reason for us choosing ... Introduction Social media and micro-blogs have entered the mainstream of society as a means for individu- als to stay in touch with friends, for companies to market products an...

Ngày tải lên: 08/03/2014, 21:20

4 317 0
Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc

Tài liệu Báo cáo khoa học: "A Syntactic Framework for Speech Repairs and Other Disruptions" doc

... states that repairs are available for semantic analysis but provides no details on the representation to be used. Clearly repairs should be available for se- mantic analysis as they play a ... the input, and this view is readily imple- mentable. The repair metarule, when given the hypo- thetical start and end of a reparandum (say from a language model such as (Heeman an...

Ngày tải lên: 20/02/2014, 19:20

8 486 0
Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

Báo cáo khoa học: "A Graphical Interface for MT Evaluation and Error Analysis" doc

... M ` arquez. 2010b. Linguistic Measures for Automatic Machine Translation Evalua- tion. Machine Translation, 24(3–4):77–86. Ahmed El Kholy and Nizar Habash. 2011. Automatic Error Analysis for ... upload word-by-word alignments between the source and any of the candidates. The alignments are also vi- sualized along with the rest of the annotations, and they can be also used to calcula...

Ngày tải lên: 16/03/2014, 20:20

6 453 0
Báo cáo khoa học: "A global model for joint lemmatization and part-of-speech prediction" doc

Báo cáo khoa học: "A global model for joint lemmatization and part-of-speech prediction" doc

... recall, and F-measure (F1) to evaluate performance. The two subtasks, tag-set prediction and lemmatization are also evaluated in this way. Table 1 shows the correct tag-sets and lemmas for each ... Pattern Analy- sis and Machine Intelligence, 20(5):522–532. Sunita Sarawagi and William Cohen. 2004. Semimarkov conditional random fields for information extraction. In ICML. Kristina...

Ngày tải lên: 17/03/2014, 01:20

9 431 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, ... enzyme, and contained Aba, Abb and Abcat 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP,...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

... International Language Resources and Evaluation (LREC’10), Val- letta, Malta. Sittichai Jiampojamarn, Kenneth Dwyer, Shane Bergsma, Aditya Bhargava, Qing Dou, Mi-Young Kim, and Grzegorz Kondrak. ... uses Hidden Markov Models (Nabende, 2010; Darwish, 2010; Jiampojamarn et al., 2010), Finite State Au- tomata (Noeman and Madkour, 2010) and Bayesian learning (Kahki et al., 2011) to learn...

Ngày tải lên: 19/02/2014, 19:20

9 521 0
Tài liệu Báo cáo khoa học: "A Large Scale Distributed Syntactic, Semantic and Lexical Language Model for Machine Translation" doc

Tài liệu Báo cáo khoa học: "A Large Scale Distributed Syntactic, Semantic and Lexical Language Model for Machine Translation" doc

... Stochastic analysis of lexical and semantic enhanced structural language model. The 8th International Colloquium on Grammatical Inference (ICGI), 97-111. K. Yamada and K. Knight. 2001. A syntax-based ... standard MapReduce paradigm (Dean and Ghemawat, 2004): the corpus is first divided and loaded into a number of clients, and n-gram counts are collected at each client, then the n...

Ngày tải lên: 20/02/2014, 04:20

10 568 0
Tài liệu Báo cáo khoa học: "A Gibbs Sampler for Phrasal Synchronous Grammar Induction" docx

Tài liệu Báo cáo khoa học: "A Gibbs Sampler for Phrasal Synchronous Grammar Induction" docx

... sentence aligned data. Marcu and Wong (2002) proposed a phrase-based alignment model which suffered from a massive parameter space and intractable inference using expectation maximisation. Taking a ... X 5 an apple ⇒ John-ga ringo-o tabeta, John ate an apple Figure 1: A fragment of an SCFG with a ternary non-terminal expansion and three terminal rules. as GIZA++. Various he...

Ngày tải lên: 20/02/2014, 07:20

9 474 1
Tài liệu Báo cáo khoa học: "A Modular Toolkit for Coreference Resolution" pdf

Tài liệu Báo cáo khoa học: "A Modular Toolkit for Coreference Resolution" pdf

... enriched with classification features by fea- ture extractors, and then handed over to a machine learning-based classifier that decides, given the fea- tures, whether anaphor and candidate are corefer- ent ... adapting BART to different corpora. Through the availability of BART as open source, as well as its modularity and adaptability, we hope to create a larger com- munity that allo...

Ngày tải lên: 20/02/2014, 09:20

4 419 0
Từ khóa:
w