... Biernat L: Aspiration- an important complication of small- bowel video capsule endoscopy. Endoscopy 2007, 39:E343. 8. Guy T, Jouneau S, D’Halluin PN, Lena H: Asymptomatic bronchial aspiration of a ... remained in the bronchial system for six days without causing airway compromise Figure 1 Capsule endoscopy. Capsule endoscopy view of the bronchial system. Figure 2 X-ray...
Ngày tải lên: 10/08/2014, 23:22
... is substantial (about half a QALY), especially as compared to the total number of QALYs usually lived after a stroke (on average 2.42 for men and 3.33 for women in usual care). The estimated lifetime ... of hospital stay, case- fatality, functional status at discharge, and destination after discharge. The research populations compare well to the demographic profile of the Neth...
Ngày tải lên: 25/10/2012, 10:35
Báo cáo y học: " Magnetic resonance imaging and mammographic appearance of dermatofibrosarcoma protuberans in a male breast: a case report and literature review" doc
... purposes) Journal of Medical Case Reports 2009, 3:8246 http://jmedicalcasereports.com/jmedicalcasereports/article/view/8246 Do you have a case to share? Submit your case report today • Rapid peer ... review • Fast publication • PubMed indexing • Inclusion in Cases Database Any patient, any case, can teach us something www.casesnetwork.com Case report Open Access Magnetic reso...
Ngày tải lên: 11/08/2014, 14:20
Báo cáo y học: "Impaired nuclear import and viral incorporation of Vpr derived from a HIV long-term non-progressor" docx
... non-progressor Leon Caly 1 , Nitin K Saksena 2 , Sabine C Piller 3,4 and David A Jans* 1 Address: 1 Department of Biochemistry and Molecular Biology, Monash University, Clayton, Victoria 3800, Australia, 2 Retroviral ... identified as a late-stage LTNP trait, further analysis of late-stage clones A6 -3 and A6 -5 (clone A6 -5 data not shown as sequence is homologous to A6...
Ngày tải lên: 13/08/2014, 05:21
Báo cáo y học: "HLA-DR regulation and the influence of GM-CSF on transcription, surface expression and shedding
... study [22]. Sample preparation and flow cytometry Arterial blood was collected from septic patients on the day sepsis was diagnosed (day 0) and on days 3, 7, and 14 for PCR studies and days ... Star). Forward HLA-DR Primer: ATCATGACAAAGCGCTCCAACTAT Reverse HLA-DR Primer: GATGCCCACCAGACCCACAG (Sigma, UK) Soluble HLA-DR measurement by ELISA Ninety six well ELISA plates (Nunc, Den...
Ngày tải lên: 03/11/2012, 09:57
Báo cáo Y học: Synthesis, conformational analysis and biological activity of cyclic analogs of the octadecaneuropeptide ODN Design of a potent endozepine antagonist pot
... Slobodyansky, E., Guidotti, A. , Wambebe, C., Berkovich, A. & Costa, E. (1989) Isolation and characterization of a rat brain triakontatetraneuropeptide, a posttranslational product of diazepam binding ... become a standard strategy in medicinal chemistry for increasing the receptor affinity and selectivity of peptide ligands [13,14,27]. The Ala-scan of OP has revealed t...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo Y học: Azidothymidine causes functional and structural destruction of mitochondria, glutathione deficiency and HIV-1 promoter sensitization pptx
... Medical Research Institute, Tokyo Medical and Dental University, Tokyo, Japan; 2 Ikawa Laboratory, RIKEN, The Institute of Physical and Chemical Research, Wako, Saitama, Japan Mitochondrial functional ... & Ames, B.N. (1987) Normal oxidative damage to mitochondrial and nuclear DNA is extensive. Proc. Natl Acad. Sci. USA 85, 6465–6467. 25. Hayakawa, M., Ogawa, T., Sugiyama, S., Tan...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo Y học: Changes in ultrastructure and the occurrence of permeability transition in mitochondria during rat liver regeneration ppt
... GDH and AAT activity in mitochondria and cytosols isolated at 24 h after PH and the enzyme activities in mitochondria and cyto- sols isolated from control rats or at 96 h after PH are statistically significant ... the cytosolic AAT was stable, there was a thermal instability of mitochondrial AAT at 70 °C [22]. The activity of mitochondrial AAT was taken as the difference between...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo y học: "On demand treatment and home therapy of hereditary angioedema in Germany - the Frankfurt experience" pptx
... current state -of- the-art review, VII: Canadian Hungarian 2007 International Consensus Algorithm for the Diagnosis, Therapy, and Managment of Hereditary Angioedema. Ann Allergy Asthma Immunol 2008, ... 10:118-133. doi:10.1186/1710-1492-6-21 Cite this article as: Aygören-Pürsün et al.: On demand treatment and home therapy of hereditary angioedema in Germany - the Frankfurt experience....
Ngày tải lên: 08/08/2014, 21:20
Báo cáo y học: "Improved cartilage integration and interfacial strength after enzymatic treatment in a cartilage transplantation model" potx
... study we found an improvement in histologi- cal and biomechanical integration of articular cartilage after treatment with a combination of hyaluronidase and collagenase, a protocol that was previously ... defects are a major problem for orthopaedic surgeons. Because cartilage has poor ability to heal because of lack of intrinsic repair capacity [1-3], chondral defects do not...
Ngày tải lên: 09/08/2014, 01:24