Báo cáo khoa học: "Tibial torus and toddler’s fractures misdiagnosed as transient synovitis: a case series" pptx

Báo cáo khoa học: "Tibial torus and toddler’s fractures misdiagnosed as transient synovitis: a case series" pptx

Báo cáo khoa học: "Tibial torus and toddler’s fractures misdiagnosed as transient synovitis: a case series" pptx

... CAS E REP O R T Open Access Tibial torus and toddler’s fractures misdiagnosed as transient synovitis: a case series Aksel Seyahi 1* , Serkan Uludag 1 , Burak Altıntaş 1 and Mehmet Demirhan 2 Abstract Introduction: ... can be made, and this can easily mask a subtle musculoskeletal in jury. Case presentations: We report the cases of three Caucasian patients (two boys...

Ngày tải lên: 10/08/2014, 23:22

4 441 0
báo cáo khoa học: " Primary choriocarcinoma of the renal pelvis presenting as intracerebral hemorrhage: a case report and review of the literature" docx

báo cáo khoa học: " Primary choriocarcinoma of the renal pelvis presenting as intracerebral hemorrhage: a case report and review of the literature" docx

... syncytiotrophoblasts and trophoblasts in a carcinomatous area (hematoxylin and eosin stain; magnification × 200). Kyriakou et al. Journal of Medical Case Reports 2011, 5:501 http://www.jmedicalcasereports.com/content/5/1/501 Page ... lesions at the area of the hematoma, a metastatic lesion situated on her left temporal lobe, whereas a magnetic angiography did not reveal any vascul...

Ngày tải lên: 10/08/2014, 23:20

4 449 0
báo cáo khoa học: "Membranous nephropathy and lupus-like syndrome after hematopoietic cell transplantation: a case report" doc

báo cáo khoa học: "Membranous nephropathy and lupus-like syndrome after hematopoietic cell transplantation: a case report" doc

... cell transplantation: a case report Kostas Stylianou 1* , Stavros Stratakis 1 , Vasiliki Mavroeidi 1 , Ioannis Petrakis 1 , Dimitris Xydakis 1 , Eleftheria Vardaki 1 , Spyros Stratigis 1 , Kostas ... three years after HCT, along with clinical and laboratory findings resembling systemic lupus erythema- tosus (SLE). Case presentation A 57-year-old Caucasian man was referred to our ren...

Ngày tải lên: 11/08/2014, 02:21

4 334 0
báo cáo khoa học: " Diagnosis of pericardial cysts using diffusion weighted magnetic resonance imaging: A case series" pot

báo cáo khoa học: " Diagnosis of pericardial cysts using diffusion weighted magnetic resonance imaging: A case series" pot

... differentiating pericardial cysts from other pericardial lesions has not yet been described. Case presentation: We present three cases (a 51-year-old Caucasian woman, a 66-year-old Caucasian woman and a ... utilized as a diagnostic tool in order to differentiate a pericardial cyst from other pericardial lesions. Case Series Case 1 A 51-year-old Caucasian woman was referre...

Ngày tải lên: 10/08/2014, 23:20

4 456 0
Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

Tài liệu Báo cáo khoa học: Identification of Ewing’s sarcoma protein as a G-quadruplex DNA- and RNA-binding protein ppt

... ACA G) and EWS reverse d(CGC TCG AGT CAC TAG TAG GGC CGA TCT CTG C), for pGEX–EWS; EAD forward d(CGG AAT TCA TGG CGT CCA CGG ATT ACA G) and EAD reverse d(CGC TCG AGT CAT CCG GAA AAT CCT CCA GAC ... to 95 °C on a thermal heating block and cooling to 4 °C at a rate of 2 °CÆmin –1 . Name Sequence ssDNAS d(CATTCCCACCGGGACCACCAC) ssDNA L d(CATTCCCACCGGGACCACCACCATTCCCACCGGGACCACCAC) ETS-...

Ngày tải lên: 15/02/2014, 01:20

11 787 0
Báo cáo khoa học: "Simultaneous Tokenization and Part-of-Speech Tagging for Arabic without a Morphological Analyzer" doc

Báo cáo khoa học: "Simultaneous Tokenization and Part-of-Speech Tagging for Arabic without a Morphological Analyzer" doc

... stem=AfAdt lAstyDAHhm lAstyDAHhm/all stem=lAstyDAHhm l/PREP + AstyDAHhm/NOA p stem=AstyDAHhm l/PREP + AstyDAH/NOA + hm/POSS PRON p stem spp:NOA p stem spp=AstyDAH for + request for clarification ... http://mallet.cs.umass.edu. Ryan Roth, Owen Rambow, Nizar Habash, Mona Diab, and Cynthia Rudin. 2008. Arabic morphologi- cal tagging, diacritization, and lemmatization using lexeme models and...

Ngày tải lên: 30/03/2014, 21:20

6 419 0
Báo cáo khoa học: " Biomass production and stool mortality in hybrid poplar coppiced twice a year" ppt

Báo cáo khoa học: " Biomass production and stool mortality in hybrid poplar coppiced twice a year" ppt

... year by living stools decreased in the biannual treatment compared to the annual treatment. The de- crease in total woody biomass expressed on an area basis was even greater ... additional irrigation and fertilization, although it would be uneco- nomical for pratical use. An analysis of root growth, such as that which was started by Bédéneau an...

Ngày tải lên: 08/08/2014, 23:22

7 250 0
Báo cáo khoa học: "Late cutaneous metastases to the face from malignant pleural mesothelioma: A case report and review of the literature" docx

Báo cáo khoa học: "Late cutaneous metastases to the face from malignant pleural mesothelioma: A case report and review of the literature" docx

... subcutaneous metastases [8,10-17]; seven of them had metastases to the face and/ or scalp. So, our case is the 11 th reported pleural Mesothelioma case with a distant subcutaneous metasta- sis and ... diagnosis was in keeping with Metastatic Mesothelioma of sarcomatous type. Discussion Malignant Mesothelioma is a rare primary neoplasm affecting the serosal membranes with a relat...

Ngày tải lên: 09/08/2014, 04:21

5 452 0
Báo cáo khoa học: "Extra-gastrointestinal stromal tumor of the greater omentum: report of a case and review of the literature" potx

Báo cáo khoa học: "Extra-gastrointestinal stromal tumor of the greater omentum: report of a case and review of the literature" potx

... K, Morinaga S, Fukayama M: Gastrointestinal stromal tumors and KIT-positive mesenchymal cells in the omentum. Pathol Int 2001, 51:524-531. 14. Sakurai S, Fukasawa T, Chong JM, Tanaka A, Fukayama M: ... clinical behavior and the prognostic factors through a review of the literature. Case presentation A 74-year-old man was admitted to the Guastalla District Hospital in October 2005 b...

Ngày tải lên: 09/08/2014, 07:21

5 365 0
Báo cáo khoa học: "Intramucosal leiomyosarcoma of the stomach following hereditary retinoblastoma in childhood – a case report and review of the literature" doc

Báo cáo khoa học: "Intramucosal leiomyosarcoma of the stomach following hereditary retinoblastoma in childhood – a case report and review of the literature" doc

... the gastric antrum was recommended and done 4 weeks later. Reexamination revealed a chronic gastritis and a scar after mucosectomy, but no tumor residuum. Perigastric lymph nodes and a paracaval lymph node ... by MiB-1, was approximately 20% (Fig. 3). The spindle cell infiltrate was classified as an unusual intramucosal leio- myosarcoma of low grade malignancy. The diagnosis was...

Ngày tải lên: 09/08/2014, 07:22

5 573 0
Từ khóa:
w